Dataset for CDS Unclassified of Organism Strigamia maritima

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|T1J047_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Strigamia maritima (length=1353 residues).
atgagcgaagccgactcggtcgccgcgccggaaagcaccgcgtcgcctcccgtcaaatgcacgcagccgccgccgccgag
attttccatcgctcacttgctttcgactgatgacaaagacattgcgatcggtaaacaaacggcaactcaacaaactccgt
tatgtgtgagaccgactccggtgtcttgccatccgttttaccatcctcatttagccgcattgggaatggacacagtggcc
gctccaaatttgcccgtagaagtcggttcgtacgctactcatcatcaacattccacgccttcctattcgataactaatac
tccgcctgcgttgctctataacagttggttaggcaggtcacaatttttaaatttacaagcgccaaaaccggtgggtagaa
gagcgagaaaacctggaatagacagaaaaccaagacaagcttatagcacgaagcaattagaaagactggagacggaattt
aaacttgataaatatcttagtgttagtaaaaggatggaattatcgcaagtacttaatttgactgaagtgcaaattaaaac
ctggtttcaaaataggagaacaaaatggaaaaaacaagtgagtgctcggatgaagatggctcagcgtcaaggattatggg
gctctccatacttaagcacaaactcagcttatcatccattcctcacttcctattatcagcagttgggaccttttgacaag
aaatcaaaaatggcgttactgcaatctaaaaaagagattaacttacaggcggaagatttaactgatgaagttgcgttgac
tggtagacaattattcacctcatttttagacgaagaaataattcacgaaggcttagaaaacccatcaaatcatgacggag
ccaccggtgatcacagtcacgaagaacttttccggaccccacaaattggaagactgggtagagatttacgagtattagct
gacgaattcgcccgatcccgagaacgatgtttagttcgcgaaagagcgaatcaagttgacgtcaactctgtaaccaaaga
caattttttccggttgatggaagagttatttgagggcggcgtgtctcgatcgcgagttgtggttttatttttcttttgtt
cggatgtagctattaacgcattacggagtaatgtggtggagattttccacaaattcgttagctgggcgctggcatttatc
acaaacacgattaccaaatgggtagaagattttggaggctggggaaaagttttgtcgcagtcatttaatctggtttataa
atgcagcgtggttgtgattggagtggctattgtggtaaccgcgggtttcttaatagccaaaaagaaaatgtag
© 1998-2018