Dataset for CDS BAX-like of Organism Sparus aurata

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0B4KJW4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Sparus aurata GN=BAX (length=579 residues).
atggcatcacaccagggagaaggcgaccaaggaaattctaaagatcagatactggaagtaggagctgttttgttgaaaga
tttcatatacgagcgggttcagcgacatggagacagcaaaaccacagtgaccagggctcagctgggtggaggagaactgt
gtgacccgaaccacaagaagcttgccatgtgcctgcagcagattggagatgagctggatggcaatgtagagctccaaagg
atgataaacaactcggcactcagtcccacaaaagatgtgtttatgaaagttgcccttgagatcttctcagatgggaagtt
caactggggcagggtggtggcactgttctactttgcctgccgactcgtcatcaaagctcttttgacccaagttcctgaca
tcatcagaacaatcatcaactggaccatggactatctccgggaacatttgatcaactggatcagggagcaaggtggctgg
gagggtattcgttcccactttggcacacccacgtggcagacggtgggtgttttcttggccggtgttctcaccactgttct
cgtcattcgcaagttgtga
© 1998-2018