Dataset for CDS Unclassified of Organism Scylla paramamosain

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1S6K8P5_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Scylla paramamosain (length=834 residues).
atgccacctcccaggcggcccaccatcaccaggagggacagtgaaagcagtggtagtaattggcagcacagtggagccaa
acaccgcaggaaccacagtgagggcaccacaagatacccacctttaccaaatctcaactgccctactaatgagtcaggag
agctacctccccatcttcctggttatggggtggacaaccatgacccccacaattctcagggattgctgtctctcactata
aggggtggtgggtacaattcccatctccctgtggccctgcagtctgctgagcgtgtcacccaggaggccgaggagctgct
taccaccttcacctcagagacccttcgcaacaataggctagaggtgccccagtggttggaggctgtgcctagcccccaca
tggttcgtgctggccgtgagctgcgtcttcttgctgatgcttttgcatgtacagctgagagacgaaaggtgcggcacatg
gcagaatcagtgaacctgagctgcattgagatggatgatttctttcagctctgtgctgagctattctatgatggtatcac
tcgggaacgcattgtagcactattcacatttgtgggagatgtggcagtgcaccaggtgaggataaagggagaggaactga
ttcaccggttaataaagtggtccctcaagtacctggtggagcatgtgtgtcgatgggtgcaggaagcaggtggctgggtt
gcagtgctgacttgtggagccaacttcctttaccgatgtgctgtattcgtcttctgcgtgtgtggttctgttgctgctgg
cctctttatatacaaaaccctaaaaaatgggtga
© 1998-2018