Dataset for CDS Unclassified of Organism Schmidtea mediterranea

[Download (right click)]

7 sequence(s)

>gnl|bcl2dbcds|H2DL12_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Schmidtea mediterranea (length=642 residues).
atggcagccggtgatgttaataacgatgaccaaatgaataagctatgcgaggaaactattgaaattttcgaatgttttgt
tgaaacacagttggaaaatgaccgtgaaagaaatcgaattgatcccggtacacccggacttccaccagaagatttgcctc
atacacccgataatagagataatgtatcatggcaaatcggaaagaaattagctggcattgcggatactttagtattagat
gaagaaagtagaggattaattagcgaaatagtgcaattagtaaatgtcggaccagatgacactagggcatttgatgaatt
ttcggaaattgctaaaaaagttatagctaatgaaatcacatgggaaaatgtagcgaccttgttttattttggttactgca
tagcacgtgaccgattgacacaaggggtacagcatttcctgtctcagttactcaagtggattgttgatattttcaagcgg
ttaggaatatttcagtggattttaaacaatggaggatggatccactttctaggatataataacaacggtgatgacacatt
cagtgtttgggtctatcggtccgccgttgttgtggtattggcctttgtttgtatttcagtgtaccgaaattatagtcgtt
aa
>gnl|bcl2dbcds|H2DL13_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Schmidtea mediterranea (length=648 residues).
atggcatcgggagataccaatgatagaattcaagatgatgatgatgaaaattatacagtgccggaacaggagtctaatac
tcaaaattttgtaacacaatttattacctcggtcgcccaaattgatattgaacgcgataaaaatgctcaagttgcacaag
atattattaatgaaacggagccattaaataatgattgttgcaacccaatcgcatctgatttgaaaagaatagcagatgaa
attgataaatcatatggaacggagtttgaaaatttagtaactaaagctataacatcaaagatcatatgtgacgcggcaaa
tgggtacaggcattttgtagaaattacagctagcatatttgaaagtggaataacgctaggaagaatctatgttttattga
tgtttggttatcgatggattgtccgcagtttgtcagttgctgccgaaacattttcagtggacgttaatcccttacaaacc
attatagggtatttagtgcgatttctttccagtgctggtgttcaggcttttattgcaagtattggtggctggaaagcaat
catgcattctcttagttcgaaagccactataatatttgccgccttagctggtgtgtttgtattcctcgcggtgattttta
acaaataa
>gnl|bcl2dbcds|H2DL14_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Schmidtea mediterranea (length=513 residues).
atggcatctaagtacaatgacaatgacaatattcattttgcagaagccgaatcaaattatttgttacaagaaatttttca
cattgaagctgaaaatgatatcagtcaaaataacaatttagaaccggcagaaatagttctaagtgctactgcaattaata
caaacaatccatttaattccagtgaatatgctgatcgtctaaaaaaaattttatctgatgttgaaaaggaaattgatgaa
ttagttaataattttgaaaaaatgactgaaacccatcaaaatgcatataatagttttgttgctattgccaatagtttatt
tgaagatggagtgagtgttagtaaactaattattttaattgtatttggttacaaatggttcactaagtgccacaggtcca
ttgctaattctatatcaatagttatgaaatttctctattcattcctcatgagtgacagaattaaatcgtttgtcattcta
cacggtggatggaaaaaactcctttttcaataa
>gnl|bcl2dbcds|H2DL15_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Schmidtea mediterranea (length=1011 residues).
atgggtgattatgatacagatgatgaattaaaaaatgacgcccattttgacgatagtattcctagtatggaggcggaatc
tatatgtgatcgtataaccaataatagttcaaacgctactccagttaataatggtgacgactattcgtctagcaattctc
atagaaatcatagacacaatccaagatgttatacagctgaagtttttgtcaaaggaattagttacgtattgaaaaaaaaa
ataaaaaattgttctccaagcaatataccgactgaaagaaagtatgtaaatttattgtctgtcgatgatggatttcaaga
agacaatccttcaccattgatgtcgtcaatttgcagcgatagagaccaaggtgctctctctgatgcatcgtctgaaggat
tttattgtcaaaatgattacaatcatgcgtgcaatgaaggactgtgtatgcatgttactccttttattagtaaactgaaa
caaaatttctttcttcctaacaatgaccaatgtgcattactccccaaattcgatgataaattttacaagtctctcgaaca
tctgattaagtatttcgaagaaaaatttaattccgattcatccgattggttgcgtacaaatgctttacagatgaatcaaa
tggataaaatacaagctcgtcaagaactcaacaaaatatttctttcaatttttagtgaaaaaatcaattggggtcgaatt
gtggcgatgattggatttgtttgtgagctatcatcttcagcatttatgattcatcgacatgatttaatcgaggaatacgt
ttacacaagcgtttcatttgtcgatgaatatttatggagttggatttttcaacatggcggatgggaaggcttaatggaat
tccaaactggtcagagtggttcgaataacgagttggagaatattttcagcagtttgagtagaatagcacgagtagcagct
ttagcgttggctggagttgcattttgtaaatatgttgctgatcatatttaa
>gnl|bcl2dbcds|H2DL17_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Schmidtea mediterranea (length=603 residues).
atgaatattgcaaactcttccagatacatttgtcaggtttatatcagtgagaaattgaaacttaggaatattgtttcggt
aaaaggggagaagtttcttataacagttcaaaatgtaccaatttacaatttgcaaattatcgcgaaattgttgctaaaag
taggcaatgaactcgatagatcatatccggatttatatagtgatataccaaatcaactgggggccggctattatccaaac
catgaactgacgaggttagcatatttgttattttgtgaacatttgacaaaatccggcatgaattgggtgaaaatggcagc
aatgttagcaatggctaatggattcgttatggattgtattcaacgcaatgaagaggaggttattgggacagtgattgaca
gtttctcggaattcgtttccaacaaccttaccaattggatgcacatgcaaaacggatggaatgtgccagaaaaatttaat
tctttgaaactatatttatcgaaaagagaaattataaatgataattctttgaagatttgtgcaataatatttgttgtttt
aattttattatatttctggctgcatgacaaccagtacttgtaa
>gnl|bcl2dbcds|H2DL18_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Schmidtea mediterranea (length=741 residues).
atgtctatcgatattatacatagttggtatgaaaaatgtataccaaaaaagccgaaggatcctccgactccagaagaagt
cattacaaatggtcatcaaatatgtaaaaccttcattgggaataaattgaaaaaattgaatctaattaagccagacaacg
tcaggagtccaaatttaaagaagcattcttttggaattttggcatatcaaggcgtaaatgtgatttctcactttatgcta
ggaccgaattcggcggctcaagcgacagagaattttaaaacgtcttgcgcagagtttcaggaaattgccgtccagctgga
aagtatgtatccggatttgtataaaaatgtcgcctctcaaatgggaattaatgttggttgggaacaacagaaaatcagtg
aagtctttttacagttttccaatgaattgctatgcaaatctggagagtctgaacctcagatttattgggcaaaaataatt
tctcttctttgtattggcgcgggcttggcagtggattgtgcaaaaaatggaaaatgggatacaattccaaaaataataga
cacatttgatcggatagttgctcagattcttatgacttggataatcagccaaaatggatggaatattccacccgagttaa
agccagacaaattttccagattaaaaaaatattttttaatatttaatacctttcttgccatttttgctgcaatacttttg
gtggcttggcgattttattag
>gnl|bcl2dbcds|H2DL20_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Schmidtea mediterranea (length=609 residues).
atggctagtaatgaagaaataattgatattgaagaagaaactagagtaatatttgagtgttatttagaagacagtcttga
aaaagacaaagaaaataacgttattgatccaggaacaccaggaattccaatggacgatctaacgactaatgacaaagaag
cttatgcaattatcgtgcaaaaattgttatctattgcaggtcaaatggatataaagagtgatccagtgttgtacaaagtt
ttaaatatggtcaatataaatgaaggattcaagtcggcttttaatgatttctctgaagtggcacaaagagttcttgataa
ccacgttaattggaacgcaatcgtatacctgtttcgatttggttatttgatagcccgagatagattggttcaaggagctc
gagatttttttaaatatctctgtcaatggatcatagacattttccgtagattttcagtatttaattggatattgagtcaa
ggaggctggaatggattgatagaaacgcacatgaattcgcatgttgtcggagctgttactgttgtcagcgtcgttgcagt
agtagcgatcattggatttgtatggttcagatcaaaaagtgctcaatga
© 1998-2018