Dataset for CDS Unclassified of Organism Schistosoma mansoni

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|G4V9D2_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Schistosoma mansoni (length=633 residues).
atgtctaattctacggatttccgactacaaacctcagtattatgtcactctttcctactagctagtacaaataaacagga
tgccagttacctgactgacttagctgacaacacgaatactgatctaacttttgttcctaatggacaagaaattatcaaat
cattacttcagttggtcagagattttaatcaacgtttcagtcgaacacatgaaatagaaccagttgctgaaagtttgggt
atcgattccgacaaaccagttgataagacagctttggaaatattctatcttgaagtattagatggcttatttgaaaaatt
aaactggggacgtattgtagcaatgtttgcatttctacgtatactggtcttaagattatccaaacatggacatagtgatg
caataaagatgcttatcaaaataacaagtcagtattccgatgagaagttgaagaattggattaatcttcatgatggttgg
tctggattaatcgaattcagtggtcaccaatttgtaaatgatggacaggaactaatctggaaaacactacgtaatgttgg
tgggcttgccactggagctgttggagcactgggtttagctgctcttgtcggttatatcgcaaataagatttaa
>gnl|bcl2dbcds|G4VKX7_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Schistosoma mansoni (length=2964 residues).
atgtctacgaatggaactgatgatggtcctttagaatcagatttaagttgggtatcaacaaagacatcatttatgacaat
ttctgatcccagtgattcatctacaccaaatgcaaattcttcattagatgaaacatttgcttcgaataagttttcaccca
actctttcagaaattcgtcgccaaaatctgacgaattagaagacaatgactatgataatggtgataaagacaaagaagaa
caagtaaaacacaagaagaaaacaggaataactttggtttatgctcctgagaaatcagctaatattttcaaatcctcaga
aaattctattgttccatctcaactaaatgaaaaagtgatcataatccgatcagatcagggcatcgataataattatactg
aaaatgatacattacctaaagaaaatggaattggatcaacaactgcttcttcaatgaatgaaattttgtattccagtaaa
gaaaacctttctaaattaaatgatgaacatgaattaataaaacagttgaataattccaacaatgtcttgtacaacaactc
atttgaggaattttcatcgaataatggaatatcggatggtaaggatctatctgataatgatgataatagtaataataata
atctatcagataatgatagtaagtacaataattccagtagtattctatcaacgcaaccagtactcacttcattgaataat
cataatgattcatcggtcttatctatggaatcaaagactttatccaaagagattctaaatgatgacgacaataataatga
taataatcaatcttatgctaacaatacaattagtgttaatgaagacaatgatatcactgatacagttctacagaatcatg
aagaaattacgaaaaatacttcgtctattgatcaaactgaagaatatacttcaacattaaaatcagttttatcttcacca
tctaatcattcaattgattcagatcaagaatacaaactactaaccgatcattcttctataaagccgaatttaaataatat
agcacaaatgaattctgaatcagatgatgaagttactaaaacagttctaaatattagcgatcaatataagaagacggtaa
ataagtttgttgagcaatcaatgccgacttatttggatcgttgttcaccagctcaaattgtagctgtaaccggtggagca
ctgccagatataatacgtaatattgaggaggatttagacgaagttaatgatgataatgttattgaagtacttaatacaga
tgcagaacatgaaaccaatccctctgcttcttcatctatgaatcctagtaatattgtccgacaacgtggtcataattcag
agtcattaaagtctcaaaagccggtaactatcaatattgatttacgagttgtttcaaagctaactccaagtactccagaa
gaagtagatgcttcatcagaactagtttttagcaattttatgatagatcgttataggttagaagtttctgcatcagctca
agcatcttcgtctcagtctactgcttcttcttcagcttcaattcatgtaacagctataggtcaacaagctgagtctgaag
atcctgtaagccatcaactttcatctttacctcgtgctgaaccacacagtgtcgaagcaatagttgctcgtaatctagcc
gaaatcggtgatgaaatcaatcgtatgtatggaccgagattagatagaatgattaaattactaccagttgaggaatgtcc
gttagaaatgttttataatgtcgcccgtgtgttatttgctcgtggtccaactaactggggtcaagtaatcactttgttct
attttggttatcggttagtagtgcaacgagttaaaaaaggtgttgccaacgcattctatcaagtatgtcgatgtctagtc
agtttttgtcgacaaatcaatattttcgtgtggatagctcaacaaggaggatggcgtattctccaattcctacgatccca
tagaacatatgatgatgatgaaaatgtagacaagaagaatcattcaactaaatcaaacgttacttctcacactgatgatg
aaagctaccaacaaaatacatcattgaatcataacccattatctgataattgtgataatgattcacagttatttgttcca
ttagtattgacaacatctattttattgagatcatttattggttatgtgtctggtgaaaatatggattggttaaacgattc
taatcatcaagttgatttatcttgttcagatctattcagtcaaactgtgaatgggaatctagatcactatagaaatggag
agcattgttattctgacagcaatgtatcaactgagtgtagcgatacatctccatctacaatttggcgtgtcaaagattat
aaatctttatacaatctaattacacaattaccacatgtctctcctgtacgagctgtttatcttcatgtattacatagtaa
tctacatgcaagacgtttctatgaaaatcgtggttttatttgtcttcatgtacgtcctggttgttatacaattgatggta
gatctgctgatggttgtacatatgttcttcatacaaatggtggacatttagattgtaaaccaataaactgtaatttaaac
actctatatgaatatttcaatgattattcagtagtatgttatctaagatggatgattcgtttgttctctcaatcaggtta
taccattttgtataaattacgtagattttcacattatctttatgataccccttcaacatttttacattcttatatacata
ataatcaaaagcaggaatatattaatcatcttcctttttcttcttcttcgtatccaatttcatcttgtttaccgcaacac
ttcactgagtattctattccagataccgcatcgacatcatcatcatgtatttcttcagattcgcctgttctaaatcataa
gtga
>gnl|bcl2dbcds|G4VRL9_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Schistosoma mansoni (length=600 residues).
atgtctggtgactgttccgtttccggtcaatgtgaagattctatgattacccaccaagttgatgaggatgatttgaagac
gatggaaacagaaacaatagttgaagaatttgtcagattaaagctaaaacaaagcgcaggaattattcaacgccgacgaa
cttcaactgatatggagacacaagctctaattggtcgtcttatagaaatatcaaatgagttagaagcccaatatggcgaa
cggttgaatcatgatgctgaaatgtggatcaagtcagccacatatgagaagtttttacagattgcaaaaggagttttctc
ggatgggattattaactggtcacgaattgtggtattgttcatgttcgctgtcaaagtggtcatcaatgcaatttccaaag
gatttagtggtcttgctggtgatatcataagatttgttgttaaatttgtttttattcatggtatatacaaatgggtcgaa
agtcatggtggttgggtggctgttttacgcgagtataccccacattctaattcaagtggtctatttgtatttggcctcac
tctgttaattgtttgcttattgttaacaagaaagatttaa
© 1998-2018