Dataset for CDS Unclassified of Organism Schistosoma japonicum

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|C1L437_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Schistosoma japonicum (length=633 residues).
atgtctaatactgcggatttccgactacaaacatcaacattatgtcactctttcctgttagctagtgcaaataaacaaga
tactgattatttgactgatttacttgataatacaaatatcgatctgacctgtgttcctaatggacaggaaattattcact
cattgcttcagttagtcggagattttaatcaacgtttcagtcaaacacatgaaatagaaccagtcgctcaaagtttgggt
atcgattccgataaaccagtcgataaaccagctttggaaatattctatcttgaaatattaaatggattgtttgaaaaatt
aaactgggggcgtatcgtagcaatgtttgcattcctacgtatattagtcttaagattgtctaaacatggacatagtgatg
caatacagatgcttattaaaacaaccagtcagtattctgatgaaaagttaaaaaattggattaatcttcatgacggttgg
tctggattaatcgaatttagtggtcgtcaatttgtaaatgatggccaagaattaatctggaaaacactacgtaatgttgg
tggacttgctactggcgctgttggagcattagggctagctgctcttgtcggttatattgcaaataagatttaa
>gnl|bcl2dbcds|C1L606_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Schistosoma japonicum (length=2172 residues).
atgtctacacatggtgtcactggtaatgctcatttggaaactgatcgaagttggacatcacaggcatcattaatgacaat
tccggatgctgacaattcatctacaccaacagcgaattcgctggatgaaacattttctccaagtgaaaattcattcaact
ctttcattacgaattcgtcaaaatctgaagtactcgaaggcgatggtagagaagtagagaggcagtcgaaagaggaagaa
agagtagagagtaaaaagaagaaaggggtgactttagtttactgtccagaaagaaaagctgctaatattttcgaatcctc
acggaattctacggtttcattggaacctggtgaaaaggagattaccatccgttcaaatcatatcattgatattaattatg
atggaaataattctataactaaagaagagaaagaaactgaattgacctcgtcgataattctaaacgaaagtattcatccc
aatgaagcctctaatcatttcaatataaacgatgaaaatcaagttatagaatcaaatgattataggaatttgtctgatga
taagatttcatctaaacggatatcaatcgaatataaaggtccatctctgtcaaataataatctatctgatgatagcaagc
gtaatgattccatcagtggtgttgtatcaacatcatcagcagaagtgctcacgtcgttgcataataacagtttgcctgtt
ttgtctaccgaatctaaaagttcgtcaaaagaaattttaaacaatctgaaacctttcgataacgtagcaattagtgttaa
tgatgaaaatgactcggttaatttacaggattatgataaaagtgataaaaccgcttcattatctattggaaaaactgaga
ggtatacatcagcatttagaccagtgctatcttcacaaccacttaataatttgaatgaatcccatcaagaatcaaaacag
ttgttaactgataattcatttatcgagtcgaatttaggtaatattgctcaaatgaacttgggattagatgatgaagttag
cgagacagttgttaatattagtgatcagcataagaaaacaataagtagatttcgtgaacaagcagtcataccaacttatt
tggatcgctgttcaccagctcaaattgttgctgtaaccggtggtgcacctgcagatattatacgtaatattgaagaagac
ttggacgacgataatgacgatagagttattgaagtgttgagtaggaatagagaaggcgttctcggtggtggtgactcaaa
tgcatcttctacgaactctgataatgttgtccgacaccgtgatcatatttcagagtcatcaaagtttcaaaaaccagtaa
ctatcaatattgacttacgagttgtttcacacctgactccaagtacaccagaagaagtagatgcttcatccgaactagtt
tttagtaattttatgatagatcgatacatgttagaagtttctgcatcagccaaggcatcttcacaatgtaatacttctgc
atcagctacagttaatatatcaagtcagcaggttatgtctgatgaccctgtaagtcatcagctttcatctttacctcggg
ctgaaccacatagtgttgaagcgatagttgctcataacctagccgaaattggtgatgaaatcaatcgtatatatggaccc
agattagatcgtatgattaaattattaccagtcgaagaatgtccattggaaatgttctataacgttgctcgtgtgttatt
tgcccgcggtccgactaactggggtcaagtgatcactttattctattttggctatcgattagtagtacaacgggttaaaa
agggaattgcaaacgccttttatcaagtatgtcgatgtttagtcagtttttgtcggaaaatcaatatttttgtttggatc
gctcagcaaggtggatggcaaattcttcagtttctgcattctgcaagaacgtgtgatgcaagtgaaagtatgagcaatga
tccaagtcattttactactcgccctgatattgagcaatcccaccaaaatacattgttgaacaataactcgtcgcctgatg
ttaatgattcccggttatttatcccattagttttgactagtactagttttgttgtgatagcttttgccctatggatctgc
atgcgccgttaa
>gnl|bcl2dbcds|C1LII7_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Schistosoma japonicum (length=2100 residues).
atgacaattccggatgctgacaattcatctacaccaacagcgaattcgctggatgaaacattttctccaagtgaaaattc
attcaactctttcattacgaattcgtcaaaatctgaagtactcgaaggcgatggcagagaagtagagaggcagtcgaaag
aggaagaaagagtagagagtaaaaagaagaaaggggtgactttagtttactgtccagaaagaaaagctgctaatattttc
gaatcctcacggaattctacggtttcattggaacctggtgaaaaggagattaccatccgttcaaatcatatcattgatat
taattatgatggaaataattctataactaaagaagagaaagaaactgaattgacctcgtcgataattctaaacgaaagta
ttcatcccaatgaagcctctaatcatttcaatataaacgatgaaaatcaagttatagaatcaaatgattataggaatttg
tctgatgataagatttcatctaaacggatatcaatcgaatataaaggtccatctctgtcaaataataatctatctgatga
tagcaagcgtaatgattccatcagtggtgttgtatcaacatcatcagcagaagtgctcacgtcgttgcataataacagtt
tgcctgttttgtctaccgaatctaaaagttcgtcaaaagaaattttaaacaatctgaaacctttcgataacgtagcaatt
agtgttaatgatgaaaatgactcggttaatttacaggattatgataaaagtgataaaaccgcttcattatctattggaaa
aactgagaggtatacatcagcatttagaccagtgctatcttcacaaccacttaataatttgaatgaatcccatcaagaat
caaaacagttgttaactgataattcatttatcgagtcgaatttaggtaatattgctcaaatgaacttgggattagatgat
gaagttagcgagacagttgttaatattagtgatcagcataagaaaacaataagtagatttcgtgaacaagcagtcatacc
aacttatttggatcgctgttcaccagctcaaattgttgctgtaaccggtggtgcacctgcagatattatacgtaatattg
aagaagacttggacgacgataatgacgatagagttattgaagtgttgagtaggaatagagaaggcgttctcggtggtggt
gactcaaatgcatcttctacgaactctgataatgttgtccgacaccgtgatcatatttcagagtcatcaaagtttcaaaa
accagtaactatcaatattgacttacgagttgtttcacacctgactccaagtacaccagaagaagtagatgcttcatccg
aactagtttttagtaattttatgatagatcgatacatgttagaagtttctgcatcagccaaggcatcttcacaatgtaat
acttctgcatcagctacagttaatatatcaagtcagcaggttatgtctgatgaccctgtaagtcatcagctttcatcttt
acctcgggctgaaccacatagtgttgaagcgatagttgctcataacctagctgaaattggtgatgaaatcaatcgtatat
atggacccagattagatcgtatgattaaattattaccaatcgaagaatgtccattggaaatgttctataacgttgctcgt
gtgttatttgcccgcggtccgactaactggggtcaagtgatcactttattctatttcggctatcgattagtagtacaacg
ggttaaaaagggaattgcaaacgccttttatcaagtatgtcgatgtttagtcagtttttgtcggaaaatcaatatttttg
tttggatcgctcagcaaggtggatggcaaattcttcaatttctacattctgcaagaacgtgtgatgcaagtgaaagtatg
agcaatgatccaagtcattttactactcgccctgatattgagcaatcccaccaaaatacattgttgaacaataactcgtc
atctgatgttaatgattcccggttatttatcccattagttttgactagtactagttttgttgtgatagcttttgtcctat
ggatctgcatgcgccgttaa
© 1998-2018