Dataset for CDS Unclassified of Organism Sarcoptes scabiei

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A132AFE6_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Sarcoptes scabiei (length=639 residues).
atgcctgaggtcggagttcttgagccgcaagatgaagtacgaatctatactaattggttattcgctgaattgacccgaga
gcagttcattcaaagtggtattgatgaggccacgatcaatgagaacgaagagctgagttttttaaacgttgaagttaata
gcaaattaatgaaacgaatagccaaggatttacaagtgatttcggatgatttcgctaaaagctctgaaagatttcgtgtt
ttggagaaagctcagcaggttaatttcgataatgtcaattatgaagattttagaggttttctaaatgaattatttcgcga
tggcatcacacgagaaaagatcgttgtcctattctatttttgcagcgatgttgttgtaagagcatattcgagtccattca
aagaacttaggcgattgttcgaatggtttctaacttacataattgatcgtattggcacatgggttctcaaccatggtgga
tggagcattgttctggggacttatatggttccagcattcacccaatcaatcttttattggctcgggagtgctgctctggt
catgttcataatcttcattgccaacaaatcttctctttctcgattctacagcggagatttcaaattaagtgtcacataa
© 1998-2018