Dataset for CDS BAX-like of Organism Sarcophilus harrisii

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G3VAK3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Sarcophilus harrisii GN=BOK (length=642 residues).
atggaggtcctgcggcgctcgtcagtgttcgcggcggaggggatggaggtgttcgaccgctcccccaccgacaaggcgct
ggtgtcccaggccaaagcgctgtgtcgggaatacatccagtcgcggctctcccgggccggcctgggctggagcaagcccg
agtacaaggcgccgacgcccggggggaagctggccgagatttccagcatcctcctgcgtctgggggatgagctggagtac
atccggcccaacgtgtaccggaacatcgcccggcagctcaacatctccctgcagtcggagagcgtggtgaccgacgcctt
cctggccgtggccactcagatcttcgcggcagggataacgtggggcaaggtggtctccctgtacgccgtggcagcggggc
tggccgtggactgcgtgcggcaggcgcagccggccatggtccacaccatcgtggactgtctgggagagtttgtgcggaag
acgctggtgacgtggctcaagcggcgcggaggctgggcagacatcatgaagtgcgtggtgaacaccgaccccagcctccg
gtctcactggctcgtggccgccctctgcagcttcgggcacttcctgaaggccatcttcttcgtcctgctccccgagagat
ga
>gnl|bcl2dbcds|G3VRP5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BAK1 (length=627 residues).
atggcttctaggcaggtgagccgggttcgagccccttcatctactgcagaggaacaggtggctctacagactgaagaggt
tttccgaagctatgtcttctatcgccatcaacaagagcaggaaagtgagggagatgctgtccttgcagacccagaaatgg
acaccctgccacaagagctcagcagttactgccccagcaccacagaacaggtgggccgacagctggccatcattggggat
aacatcattcgcaggtataactcagaatttgaggccatgctgcagcatttgcagcccaccccggaaactgcctatgagag
cttcgtcaagatcgcctccagcctatttgaaagcggcatcaactggggccgagtggtggcactgctgggctttggctacc
ggctggcactatatgtttatcggaggggtctgactggcttcctgggccatgtggctcgcttcgtggctgacttcatgctc
caacactttgtcacccgctggattgcccagaacgggggctgggtggcagccctggacctctccaacaactccatttggta
cgtgatgacaatcttggggatggtgctcttgggtcgattcattatccgaagattctttcaaccctga
© 1998-2018