Dataset for CDS BAX of Organism Salmo salar

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|B5X0Y9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Salmo salar GN=BAX (length=615 residues).
atggcagactcccgagaaagaaggaaaactggcgaagatgagcctcagggtgcattcgggggtgaagatgtcaacgacga
cagaattatggaacaaggagctattgttttaagagggtatgtcatagagaggatcagtgcagaaaacccagcgaggcatt
tggctccagaggaccttggtggcagacccaacgaacaagaggaccaccaagtcaaagacgtggtacaccagctgctgctg
atcgctgatgacctgaacagaaatgctgagctacaacacctaataagcagagtccaggtaaactgtgcccaggatgtgtt
cttctcagtggccagggaaatctttgcagatggtatcaactggggcagagtggtctccctgtttcacttggcctacaagc
ttatttacaaggcactgacacagaaccacttagaaatcatcaagaaggttattagctgggtattacagttcatcagggaa
aatgtctccgcttggatccgacagcaaggaggatgggaggcggttgttagcactgtgtcacattggcgtacggtgtcgct
tgtggctgcagtggctttcgtggcggtcatggtttactggaggaaaatacgctga
>gnl|bcl2dbcds|B5X9C5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Salmo salar GN=BAX (length=615 residues).
atggcagactcccgagaaagaaggaaaactggcgaagatgagcctcagggtgcattcgggggtgaagatgtcaacgacga
cagaattatggaacaaggagctattgttttaagagggtatgtcatagagaggatcagtgcagaaaacccagcgaggcatt
tggctccagaggaccttggtggcagacccaacgaacaagaggaccaccaagtcaaagacgtggtacaccagctgctgctg
atcgctgatgacatgaacagaaatgctgagctacaacacctaataagcagagtccaggtaaactgtgcccaggatgtgtt
cttctcagtggccaaggaaatctttgcagatggtatcaactggggcagagtggtctccctgtttcacttggcctacaagc
ttatttacaaggcactgacacagaaccacttagaaatcatcaagaaggttattagctgggtattacagttcatcagggaa
aatgtctccgcttggatccgacagcaaggaggatgggaggcggttgttagcactgtgtcacattggcgtacggtgtcgct
tgtggctgcagtggctttcgtggcggtcatggtttactggaggaaaacacgctga
>gnl|bcl2dbcds|B5XC79_BAX-01 BCL2-associated X gene OS=[Eukaryota] Salmo salar GN=BAX (length=615 residues).
atggcagactcccgagaaagaaggaaaaccggcgaagatgagcctcagggtgcagtcgggggtgaagatgtcatcgacga
cagaattatggaacaaggagctgttgttttaagagggtatgtcatcgagagggtcagtgcagaaaacccagagaggcgtt
tggctccagaggaccttggtggcagacccaacgaacaagaggaccaccaagtcaaagacgtggtacaccagctgctgctg
atcgctgatgacctgaacagaaatgctgagctacaacacctaataagcacagtccaggtgaactgtgcccaggatgtgtt
cttctcagtggccagggaaatctttgcagatggtatcaactggggcagagtggtcacactgtttcacttggcctacaagc
ttatttacaaggcactgacacagaaccacttagaaatcatcaagaaggttattagctgggtattacagttcatcagggaa
aatgtctccgcttggatccgacagcaaggaggatgggaggcggctgttagcaccgtgtcacattggcgtactgtgtcact
tgtggctgcagtggctttcgtgacggccatggtttactggaggaaaacacgctga
>gnl|bcl2dbcds|E0R7W0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Salmo salar GN=BAX (length=615 residues).
atggcagactcccgagaaagaaggaaaactggcgaagatgagcctcagggtgcattcgggggtgaagatgtcaacgacga
cagaattatggaacaaggagctattgttttaagagggtatgtcatagagaggatcagtgcagaaaacccagcgaggcatt
tggctccagaggaccttggtggcagacccaacgaacaagaggaccaccaagtcaaagacgtggtacaccagctgctgctg
atcgctgatgacctgaacagaaatgctgagctacaacacctaataagcagagtccaggtaaactgtgcccaggatgtgtt
cttctcagtggccagggaaatctttgcagatggtatcaactggggcagagtggtctccctgtttcacttggcctacaagc
ttatttacaaggcactgacacagaaccacttagaaatcatcaagaaggttattagctgggtattacagttcatcagggaa
aatgtctccgcttggatccgacagcaaggaggatgggaggcggttgttagcactgtgtcacattggcgtacggtgtcgct
tgtggctgcagtggctttcgtggcggtcatggtttactggaggaaaacacgctga
© 1998-2018