Dataset for CDS BOK of Organism Saimiri boliviensis boliviensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K6T885_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BOK (length=531 residues).
atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgcctttgaccgctcgcccacggacaaggagct
ggtggcccaggccaaagcgctgggccgggaatacgtgcacgcgcggctgctgcgcgccggcctctcctggagcgcgcccg
agcgcgccgcgccagtcccggggcgcctggccgaggtgtgcgccgtgctgctgcgcctgggtgatgagctggagatgatc
cggcccagcgtctaccgcaacgtggcacgccagctgcacatccccctgcagtctgagcccgtggtgactgacgcgttcct
ggccgtggctggccacatcttctccgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggcggcagggctgg
ctgtgactgatgtcctcaagtgtgtggtcagcacagaccctggcctccgctcccactggctgctcgccgcgctctgcagc
ttcggccgcttcctgaaggctgccttcttcgtgctcctgccagagagatga
© 1998-2018