Dataset for CDS BAX of Organism Saimiri boliviensis boliviensis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2K6UFS4_BAX-04 BCL2-associated X gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAX (length=543 residues).
cccaccagctctgagcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatcgg
aggggaggcacccgagctggccctggacccggtgccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgca
tcggagacgaactggacagtaacatggagctgcagaggatgatcgccactgtggacacaaactccccccgagaggtcttt
ttccgagtggcggctgacatgttctctgatggcaacttcaactggggccgggttgtcgcctttttctactttgccagcaa
actggtgctcaaggccctgtgtgccaaggtgcccgagctgatcagaaccatcatgggctggactttggacttcctccggg
agcggctgttgggctggatccaagaccagggtggttgggatagcctcctctcctactttgggacacccacgtggcagaca
gtgaccatctttgtggctggagtgctcaccgcctcacttaccatctggaagaacatgggctga
>gnl|bcl2dbcds|A0A2K6UFS4_BAX-05 BCL2-associated X gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAX (length=396 residues).
cccaccagctctgagcagatcatgaagacaggggcccttttgcttcaggggatgatcgccactgtggacacaaactcccc
ccgagaggtctttttccgagtggcggctgacatgttctctgatggcaacttcaactggggccgggttgtcgcctttttct
actttgccagcaaactggtgctcaaggccctgtgtgccaaggtgcccgagctgatcagaaccatcatgggctggactttg
gacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggatagcctcctctcctactttgggacacc
cacgtggcagacagtgaccatctttgtggctggagtgctcaccgcctcacttaccatctggaagaacatgggctga
© 1998-2018