Dataset for CDS Unclassified of Organism Rhodnius prolixus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|T1H8N9_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Rhodnius prolixus (length=744 residues).
atggcaacgttaattaaattttttaaaatgagctttcaagatgaagaagaaatttctgacaataatttattacaggaaga
attaaagttattgtcagcaatcgatattggtattgttggtaatagttgtaaagaaaatgatggaaaattaccaactaaag
aaaatttagacactactaatgaggaaggaaaattagctaaagataggaaaaaattagaaattatagccgaatgtgattat
ctggctagactggttgtggaacagaggttaggttcttctcgatgtaaggttgatgaacgtcacactgaagtctggaagta
cttgatgcgaggtatggaactctacatcaataatggtagtaatctactggaagggaaagctagaaacctgtggatcacca
ataaatgtgaatatagtacattccaggaaatagctagcgaattggtactgaggaaaatttcctggatccaaatttgtgga
ctgttcgctttgctggatagactggcagctttctgtaaaatgttcgggcgttcgtatgtggctaaattggctgcaggaca
tttggctacctttattgtagaaaatagtaagataatagacttcctggaagagaatggaggatgggttaacatttttgaaa
agaaattaatggtacaagatattgaagattttaaaaggaatttgtacataaatagtgtaaaaatcatagctgttggccta
atatgcctatggagatattggtag
© 1998-2018