Dataset for CDS BOK of Organism Rhinopithecus roxellana

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K6Q8Q6_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Rhinopithecus roxellana GN=BOK (length=639 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggatgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctactgcgcgccggcctctcctggagcgcgcccg
agcgcgccgcgccggtcccgggacgcctggccgaggtgtgcgcggtgctcctgcgcctgggggatgagctggagatgatc
cggcccagcgtctaccgcaacgtggctcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcct
ggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccttgtatgcggtggccgcagggctgg
ccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctgggggagtttgtgcgcaagacc
ctggcaacctggctgcggagacgcggtggatggactgatgtcctcaaatgtgtggtcagcacagaccctggcctccgctc
ccactggctggtagctgcactgtgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
© 1998-2018