Dataset for CDS BAX-like of Organism Rhinopithecus roxellana

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A2K6N8C5_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAK1 (length=462 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccttctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttgcccctgcaacctagcagcaccatgggacaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccaggccagcaacaacacccacagcctgtttgagagtggcatcaactggggccg
tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcgcggcctga
>gnl|bcl2dbcds|A0A2K6N8C5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAK1 (length=636 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccttctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttgcccctgcaacctagcagcaccatgggacaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcgcggcctgactggcttcctgggccaggtgacccgcttcgtggtcgat
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K6N8C5_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAK1 (length=579 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccttctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcagaacccctctgccatgagccaaggcc
tggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcac
ctgcagcccacggcagagaacgcctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactgggg
ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcgcggcctgactggcttcctgggcc
aggtgacccgcttcgtggtcgatttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggca
gccctgaacttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacg
aagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K6NSH2_BAX-04 BCL2-associated X gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAX (length=555 residues).
atggacgggtccggggagcagcccagaggcgggggagcgacaccccgttctgattctgcaccctcactccatccccactc
taggcgaatggggggggagacacccgagctggccctggacccagtgcctcaggatgcgtccaccaagaggctgagcgagt
gtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgccgccgtggacacagactccccc
cgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
ctttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatcagaaccatcatgggctggacactgg
acttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggcctcctctcctactttgggacgccc
acgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K6NSH2_BAX-05 BCL2-associated X gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAX (length=591 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccagtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
ctcctcaaccctcctcaccccaaccaccgcccctgccccactgtcccttggtgccctctccccatctttggatcatcaga
tgtggtctataatgcatttccttacgtgtct
>gnl|bcl2dbcds|A0A2K6NSH2_BAX-02 BCL2-associated X gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccagtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K6NSH2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAX (length=522 residues).
atgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggc
cctggacccagtgcctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagta
acatggagctgcagaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatg
ttttctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtg
taccaaggtgcccgaactgatcagaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatcc
aagaccagggtggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctgga
gtactcaccgcctccctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K6NSH2_BAX-03 BCL2-associated X gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtg
cccgaactgatcagaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccaggg
tggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccg
cctccctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K6Q8Q6_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Rhinopithecus roxellana GN=BOK (length=639 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggatgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctactgcgcgccggcctctcctggagcgcgcccg
agcgcgccgcgccggtcccgggacgcctggccgaggtgtgcgcggtgctcctgcgcctgggggatgagctggagatgatc
cggcccagcgtctaccgcaacgtggctcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcct
ggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccttgtatgcggtggccgcagggctgg
ccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctgggggagtttgtgcgcaagacc
ctggcaacctggctgcggagacgcggtggatggactgatgtcctcaaatgtgtggtcagcacagaccctggcctccgctc
ccactggctggtagctgcactgtgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
© 1998-2018