Dataset for CDS BAK1 of Organism Rhinopithecus roxellana

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A2K6N8C5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAK1 (length=636 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccttctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttgcccctgcaacctagcagcaccatgggacaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcgcggcctgactggcttcctgggccaggtgacccgcttcgtggtcgat
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K6N8C5_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAK1 (length=579 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccttctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcagaacccctctgccatgagccaaggcc
tggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcac
ctgcagcccacggcagagaacgcctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactgggg
ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcgcggcctgactggcttcctgggcc
aggtgacccgcttcgtggtcgatttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggca
gccctgaacttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacg
aagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2K6N8C5_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAK1 (length=462 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccttctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttgcccctgcaacctagcagcaccatgggacaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccaggccagcaacaacacccacagcctgtttgagagtggcatcaactggggccg
tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcgcggcctga
© 1998-2018