Dataset for CDS BAX of Organism Rhinopithecus bieti

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A2K6MIN3_BAX-04 BCL2-associated X gene OS=[Eukaryota] Rhinopithecus bieti GN=BAX (length=591 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccagtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
ctcctcaaccctcctcaccccaaccaccgcccctgccccactgtcccttggtgccctctccccatctttggatcatcaga
tgtggtctataatgcatttccttacgtgtct
>gnl|bcl2dbcds|A0A2K6MIN3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Rhinopithecus bieti GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccagtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K6MIN3_BAX-02 BCL2-associated X gene OS=[Eukaryota] Rhinopithecus bieti GN=BAX (length=555 residues).
atggacgggtccggggagcagcccagaggcgggggagcgacaccccgttctgattctgcaccctcactccatccccactc
taggcgaatggggggggagacacccgagctggccctggacccagtgcctcaggatgcgtccaccaagaggctgagcgagt
gtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgccgccgtggacacagactccccc
cgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactggggccgtgttgtcgcccttttcta
ctttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatcagaaccatcatgggctggacactgg
acttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggcctcctctcctactttgggacgccc
acgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K6MIN3_BAX-03 BCL2-associated X gene OS=[Eukaryota] Rhinopithecus bieti GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtg
cccgaactgatcagaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccaggg
tggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccg
cctccctcaccatctggaagaagatgggctga
© 1998-2018