Dataset for CDS BOK of Organism Rattus norvegicus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|G0YKA8_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Rattus norvegicus GN=BOK (length=363 residues).
atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgcctttgatcgctcgcccacagacaaggagct
ggtggcccaggctaaagcactaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctggagcgctccag
agcgtgcctcgcctgcccctggaggacgcctggcagaggtgtgcaccgtgctgctgcgcttgggagatgagctggagcag
atccgtcccagcgtatatcggaatgtggcccggcagctgcacatccccctgcagtctgagcctgtggtgactgatgcctt
cctcgctgtggccggccacatcttctcagcaggaagacattga
>gnl|bcl2dbcds|Q792S6_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Rattus norvegicus GN=BOK (length=513 residues).
atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgcctttgatcgctcgcccacagacaaggagct
ggtggcccaggctaaagcactaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctggagcgctccag
agcgtgcctcgcctgcccctggaggacgcctggcagaggtgtgcaccgtgctgctgcgcttgggtatcacatggggcaag
gtagtgtccctgtactcggtggctgcgggactagcggtggactgcgtccggcaagctcagccagccatggttcatgccct
ggttgactgcctgggggaatttgtacgcaagaccctggccacctggcttcggaggcgtggtggatggacggacgtcctca
agtgtgtggtcagcacagaccctggcttccgctcccactggctcgtggccacactctgcagctttggccgcttcctgaag
gctgcattcttcctcctgttgccagagagatga
>gnl|bcl2dbcds|Q792S6_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Rattus norvegicus GN=BOK (length=642 residues).
atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgcctttgatcgctcgcccacagacaaggagct
ggtggcccaggctaaagcactaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctggagcgctccag
agcgtgcctcgcctgcccctggaggacgcctggcagaggtgtgcaccgtgctgctgcgcttgggagatgagctggagcag
atccgtcccagcgtatatcggaatgtggcccggcagctgcacatccccctgcagtctgagcctgtggtgactgatgcctt
cctcgctgtggccggccacatcttctcagcaggtatcacatggggcaaggtagtgtccctgtactcggtggctgcgggac
tagcggtggactgcgtccggcaagctcagccagccatggttcatgccctggttgactgcctgggggaatttgtacgcaag
accctggccacctggcttcggaggcgtggtggatggacggacgtcctcaagtgtgtggtcagcacagaccctggcttccg
ctcccactggctcgtggccacactctgcagctttggccgcttcctgaaggctgcattcttcctcctgttgccagagagat
ga
© 1998-2018