Dataset for CDS BAX-like of Organism Rattus norvegicus

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|G0YKA8_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Rattus norvegicus GN=BOK (length=363 residues).
atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgcctttgatcgctcgcccacagacaaggagct
ggtggcccaggctaaagcactaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctggagcgctccag
agcgtgcctcgcctgcccctggaggacgcctggcagaggtgtgcaccgtgctgctgcgcttgggagatgagctggagcag
atccgtcccagcgtatatcggaatgtggcccggcagctgcacatccccctgcagtctgagcctgtggtgactgatgcctt
cctcgctgtggccggccacatcttctcagcaggaagacattga
>gnl|bcl2dbcds|Q63690_BAX-01 BCL2-associated X gene OS=[Eukaryota] Rattus norvegicus GN=BAX (length=402 residues).
agaggatggctggggagacacctgagctgaccttggagcagccgccccaggacgcatccaccaagaagctgagcgagtgt
ctcaggcgaattggcgatgaactggacaacaacatggagctgcagaggatgattgctgatgtggatacagactccccccg
agaggtcttcttccgtgtggcagctgacatgtttgcagacggcaacttcaactggggccgggtggttgcccttttctact
ttgctagcaaactggtgctcaaggccctgtgcactaaagtgcccgagctgatcagaaccatcatgggctggacactggac
ttcctccgggagcggctgtttgtctggatccaagaccagggtggctgggatggcctcctttcctacttcgggacgcccac
at
>gnl|bcl2dbcds|Q792S6_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Rattus norvegicus GN=BOK (length=642 residues).
atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgcctttgatcgctcgcccacagacaaggagct
ggtggcccaggctaaagcactaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctggagcgctccag
agcgtgcctcgcctgcccctggaggacgcctggcagaggtgtgcaccgtgctgctgcgcttgggagatgagctggagcag
atccgtcccagcgtatatcggaatgtggcccggcagctgcacatccccctgcagtctgagcctgtggtgactgatgcctt
cctcgctgtggccggccacatcttctcagcaggtatcacatggggcaaggtagtgtccctgtactcggtggctgcgggac
tagcggtggactgcgtccggcaagctcagccagccatggttcatgccctggttgactgcctgggggaatttgtacgcaag
accctggccacctggcttcggaggcgtggtggatggacggacgtcctcaagtgtgtggtcagcacagaccctggcttccg
ctcccactggctcgtggccacactctgcagctttggccgcttcctgaaggctgcattcttcctcctgttgccagagagat
ga
>gnl|bcl2dbcds|Q792S6_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Rattus norvegicus GN=BOK (length=513 residues).
atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgcctttgatcgctcgcccacagacaaggagct
ggtggcccaggctaaagcactaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctggagcgctccag
agcgtgcctcgcctgcccctggaggacgcctggcagaggtgtgcaccgtgctgctgcgcttgggtatcacatggggcaag
gtagtgtccctgtactcggtggctgcgggactagcggtggactgcgtccggcaagctcagccagccatggttcatgccct
ggttgactgcctgggggaatttgtacgcaagaccctggccacctggcttcggaggcgtggtggatggacggacgtcctca
agtgtgtggtcagcacagaccctggcttccgctcccactggctcgtggccacactctgcagctttggccgcttcctgaag
gctgcattcttcctcctgttgccagagagatga
>gnl|bcl2dbcds|Q9JK59_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Rattus norvegicus GN=BAK1 (length=630 residues).
atggcatccggacaaggaccaggtcctcccaagggggactgcgatgaggccctgtctgcttctgaacagcaagttgccca
ggacacagaggaggtctttcgaagctacgttttttacctccaccagcaggaacaagagacccagggggcagccgcccctg
ctaaccctgagatggacaacttgtccctagaacccaacagtgtcttgggtcaggtgggtcggcagcttgctctcatcgga
gacgatattaatcggcgctacgacacggagttccagaatttactggaacagcttcagcccaccgctgggaatgcctacga
actcttcaccaagatcgcctccagcctatttaagagcggcatcagctggggccgtgtggtggctctcctgggctttggct
accgtctggccctgtatgtctaccagcgtggtttgactggcttcctgggccaggtgacctgctttttggctgatatcata
ctacaccattacattgccagatggattgcacagagaggtggttgggtggcagccctgagtttgcgtagagaccccatcct
gagtgtagtggtaatttttggtgtggttctgttgggccaatttgtggtacacagattcttcagatcatga
>gnl|bcl2dbcds|Q9JKL3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Rattus norvegicus GN=BAX (length=579 residues).
atggacgggtccggggatcatctcggaggcggcgggcccaccagctctgaacagatcatgaagacaggggcctttttgct
acagggtttcatccaggatcgagcagagaggatggctggggagacacctgagctgaccttggagcagccgccccaggacg
catccaccaagaagctgagcgagtgtctcaggcgaattggcgatgaactggacaacaacatggagctgcagaggatgatt
gctgatgtggatacagactccccccgagaggtcttcttccgtgtggcagctgacatgtttgcagacggcaacttcaactg
gggccgggtggttgcccttttctactttgctagcaaactggtgctcaaggccctgtgcactaaagtgcccgagctgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgcttgtctggatccaagaccagggtggctgggatggc
ctcctttcctacttcgggacccccacatggcagacagtgaccatctttgtggctggagtcctcactgcctcactcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|Q9JKL3_BAX-02 BCL2-associated X gene OS=[Eukaryota] Rattus norvegicus GN=BAX (length=522 residues).
atgaagacaggggcctttttgctacagggtttcatccaggatcgagcagagaggatggctggggagacacctgagctgac
cttggagcagccgccccaggacgcatccaccaagaagctgagcgagtgtctcaggcgaattggcgatgaactggacaaca
acatggagctgcagaggatgattgctgatgtggatacagactccccccgagaggtcttcttccgtgtggcagctgacatg
tttgcagacggcaacttcaactggggccgggtggttgcccttttctactttgctagcaaactggtgctcaaggccctgtg
cactaaagtgcccgagctgatcagaaccatcatgggctggacactggacttcctccgggagcggctgcttgtctggatcc
aagaccagggtggctgggatggcctcctttcctacttcgggacccccacatggcagacagtgaccatctttgtggctgga
gtcctcactgcctcactcaccatctggaagaagatgggctga
© 1998-2018