Dataset for CDS BAX of Organism Rattus norvegicus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|Q63690_BAX-01 BCL2-associated X gene OS=[Eukaryota] Rattus norvegicus GN=BAX (length=402 residues).
agaggatggctggggagacacctgagctgaccttggagcagccgccccaggacgcatccaccaagaagctgagcgagtgt
ctcaggcgaattggcgatgaactggacaacaacatggagctgcagaggatgattgctgatgtggatacagactccccccg
agaggtcttcttccgtgtggcagctgacatgtttgcagacggcaacttcaactggggccgggtggttgcccttttctact
ttgctagcaaactggtgctcaaggccctgtgcactaaagtgcccgagctgatcagaaccatcatgggctggacactggac
ttcctccgggagcggctgtttgtctggatccaagaccagggtggctgggatggcctcctttcctacttcgggacgcccac
at
>gnl|bcl2dbcds|Q9JKL3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Rattus norvegicus GN=BAX (length=579 residues).
atggacgggtccggggatcatctcggaggcggcgggcccaccagctctgaacagatcatgaagacaggggcctttttgct
acagggtttcatccaggatcgagcagagaggatggctggggagacacctgagctgaccttggagcagccgccccaggacg
catccaccaagaagctgagcgagtgtctcaggcgaattggcgatgaactggacaacaacatggagctgcagaggatgatt
gctgatgtggatacagactccccccgagaggtcttcttccgtgtggcagctgacatgtttgcagacggcaacttcaactg
gggccgggtggttgcccttttctactttgctagcaaactggtgctcaaggccctgtgcactaaagtgcccgagctgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgcttgtctggatccaagaccagggtggctgggatggc
ctcctttcctacttcgggacccccacatggcagacagtgaccatctttgtggctggagtcctcactgcctcactcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|Q9JKL3_BAX-02 BCL2-associated X gene OS=[Eukaryota] Rattus norvegicus GN=BAX (length=522 residues).
atgaagacaggggcctttttgctacagggtttcatccaggatcgagcagagaggatggctggggagacacctgagctgac
cttggagcagccgccccaggacgcatccaccaagaagctgagcgagtgtctcaggcgaattggcgatgaactggacaaca
acatggagctgcagaggatgattgctgatgtggatacagactccccccgagaggtcttcttccgtgtggcagctgacatg
tttgcagacggcaacttcaactggggccgggtggttgcccttttctactttgctagcaaactggtgctcaaggccctgtg
cactaaagtgcccgagctgatcagaaccatcatgggctggacactggacttcctccgggagcggctgcttgtctggatcc
aagaccagggtggctgggatggcctcctttcctacttcgggacccccacatggcagacagtgaccatctttgtggctgga
gtcctcactgcctcactcaccatctggaagaagatgggctga
© 1998-2018