Dataset for CDS BOK of Organism Propithecus coquereli

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K6ES66_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Propithecus coquereli GN=BOK (length=642 residues).
atggaggtgctgcggcgctcctcggtcctcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctgggcagggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggagcgtgcccg
agcgcgccgcgctcgtcccgggaggccgcctggcggaggtgtccgcggtgctgctgcgcctgggggatgagctggagctg
atccggcccagcgtgtaccgcaacgtggcgcggcagctgcacatctccctgcagtccgagcccgtggtgactgatgcgtt
cctggccgtggcaggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtacgcggtggccgcagcgc
tggccgtggactgcgtgcggcaggcccagccagccatggtccacgccctcgtcgactgcttgggagagtttgtgcgcaag
accctggcgacctggctgcggaggcgcggtggatggactgacgtcctcaagtgcgtggtcagcacggagcctggcctccg
ctcccactggctggtggctgcgctctgcggcgcctgccgcttcctgagggctgccttcttcatgctgctgccagaaagat
ga
© 1998-2018