Dataset for CDS BAX-like of Organism Propithecus coquereli

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A2K6ES66_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Propithecus coquereli GN=BOK (length=642 residues).
atggaggtgctgcggcgctcctcggtcctcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctgggcagggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggagcgtgcccg
agcgcgccgcgctcgtcccgggaggccgcctggcggaggtgtccgcggtgctgctgcgcctgggggatgagctggagctg
atccggcccagcgtgtaccgcaacgtggcgcggcagctgcacatctccctgcagtccgagcccgtggtgactgatgcgtt
cctggccgtggcaggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtacgcggtggccgcagcgc
tggccgtggactgcgtgcggcaggcccagccagccatggtccacgccctcgtcgactgcttgggagagtttgtgcgcaag
accctggcgacctggctgcggaggcgcggtggatggactgacgtcctcaagtgcgtggtcagcacggagcctggcctccg
ctcccactggctggtggctgcgctctgcggcgcctgccgcttcctgagggctgccttcttcatgctgctgccagaaagat
ga
>gnl|bcl2dbcds|A0A2K6FT73_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Propithecus coquereli GN=BAK1 (length=636 residues).
atggcatctgggcaaggcccaggtcctcccgggcaggggtgcggagagcctgccccgcctcccacttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggagcaggaggccgagggggcagctg
ccctcgctgacccagagatggacaccttgcccctagagcctagcagcaccatggggcaggtgggtcgacagctcgccatc
atcggggacgacatcaaccggcgctatgacgcggagttccagaccatgctgcagcacctgcagcccacagcagagaatgc
ctacgagtatttcatcaagatcgccacgagcctgtttgagagtggcataaactggggtcgtgtggtggctctcctgggct
tcggctaccgcctggctctgcacgtttaccagcgcggcctgactggcttcctgggccaggtgacccgcttcgtggccgac
ttcatgctgcatcactacatcgcccggtggatcgcacagaggggcggctgggtggcagccctggacttgggcaatggccc
catccggaatgtgctgctggttctggccgtggttctgttgggccagttcgtggtacgaagattcttcaactcatga
>gnl|bcl2dbcds|A0A2K6FZV4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Propithecus coquereli GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggaagcacccgagctgggtctggagccgacgccccaggatg
catccaccaagaagctgagcgagtgtctcaagcgcatcggggatgaactggacagtaacatggagctgcagagaatgatt
gctgctgtggacacagactccccccgtgaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctacttcgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagctgatca
gaaccattatgggctggacgatggacttcctccgagagcggctgctgggctggatccaagaccagggtggttgggacggc
cttctctcctactttggaaccccgacgtggcaaacagtgaccatctttgtggccggagtgctcaccgcctcgctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K6FZV4_BAX-02 BCL2-associated X gene OS=[Eukaryota] Propithecus coquereli GN=BAX (length=522 residues).
atggacgggtccggggagcagcccagaggcgggggtgaggcgggagcagggcgaatggggggggaagcacccgagctggg
tctggagccgacgccccaggatgcatccaccaagaagctgagcgagtgtctcaagcgcatcggggatgaactggacagta
acatggagctgcagagaatgattgctgctgtggacacagactccccccgtgaggtctttttccgagtggcagctgacatg
ttttctgacggcaacttcaactggggccgggttgtcgcccttttctacttcgccagcaaactggtgctcaaggccctgtg
caccaaggtgcccgagctgatcagaaccattatgggctggacgatggacttcctccgagagcggctgctgggctggatcc
aagaccagggtggttgggacggccttctctcctactttggaaccccgacgtggcaaacagtgaccatctttgtggccgga
gtgctcaccgcctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K6FZV4_BAX-03 BCL2-associated X gene OS=[Eukaryota] Propithecus coquereli GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggaatgattgctgctgtggacacagactccccccgtgaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgggttgtcgcccttttctacttcgccagcaaactggtgctcaaggccctgtgcaccaaggtg
cccgagctgatcagaaccattatgggctggacgatggacttcctccgagagcggctgctgggctggatccaagaccaggg
tggttgggacggccttctctcctactttggaaccccgacgtggcaaacagtgaccatctttgtggccggagtgctcaccg
cctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2K6FZV4_BAX-04 BCL2-associated X gene OS=[Eukaryota] Propithecus coquereli GN=BAX (length=597 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggaagcacccgagctgggtctggagccgacgccccaggatg
catccaccaagaagctgagcgagtgtctcaagcgcatcggggatgaactggacagtaacatggagctgcagagaatgatt
gctgctgtggacacagactccccccgtgaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctacttcgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagctgatca
gaaccattatgggctggacgatggacttcctccgagagcggctgctgggctggatccaagaccagggtggttgggtgaga
ccccgcaacccagccccaccccacctgggaccccactgggccttcccgcaccagaggtgccctctccccattttcagatc
atcagctgtagtctgtaatgtttccttacttgtccca
© 1998-2018