Dataset for CDS Unclassified of Organism Pongo abelii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2NK01_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pongo abelii (length=444 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagcaacgtttttcaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttacctctctgcaacctagcagcaccatggggcaggtgggacggcagctcgcca
tcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgttacagcacctgcagcccacggcagagaat
acctgtgagtacttcaccaagattgcctccagcctttttgagagtggcatcaattggggccgtgtggtggctcttctggg
cttcggctaccgtctggccctacacgtctaccatcgcggcctga
© 1998-2018