Dataset for CDS BAX-like of Organism Pongo abelii

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|H2NZJ1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Pongo abelii GN=BAX (length=741 residues).
atggcgccacggctggcacttatctggagatgctcattggacagtcacgtgacgggaccaagcctcccgagggagcgagg
caggtgcggtcacgtgacccagcggcgctgcggggcagcggccattttgcggggcggccacgtgagggacgcacgttcag
cggggctctcacgtgacccgggcgcgctgcggccgcccgcgcggacccggcgagaggcggcggcgggagcggcggtgatg
gacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgcttca
gggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatgcgt
ccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgcc
gccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactgggg
ccgggttgtcgccctttggacattggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacg
gcctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttcgtggctggagtactcaccgcctcactcacc
atctggaagaagatgggctga
>gnl|bcl2dbcds|H2P970_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Pongo abelii GN=BOK (length=639 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccacagacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctactgcgcgccggcctctcctggagcgcgcccg
agcgcgccgcgccggtcccgggacgcctggctgaggtgtgcgcggtgctgctgcgcctgggggatgagctggagatgatc
cggcccagcgtctaccgcaacgtggcgcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcct
ggccgtggctggccacatcttctctgcaggcatcacatggggcaaggtggtgtccctgtatgcggtggccgcggggctgg
ccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctgggggagttcgtgcgcaagacc
ctggcaacctggctgcggagacgtggcggatggactgatgtcctcaagtgtgtggtcagcacagaccctggcctccgctc
ccactggctggtagccgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
>gnl|bcl2dbcds|H2PIQ6_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pongo abelii GN=BAK1 (length=519 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttacctctgcaacctagctatgagtacttcaccaagattgcctccagcctgttt
gagagtggcatcaactggggccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcgcgg
cctgactggcttcctgggccaggtgacgcgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcac
agaggggtggctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtggttctg
ttgggccagtttgtggtacgaagattcttcaaatcatga
© 1998-2018