Dataset for CDS BAX of Organism Pongo abelii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2NZJ1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Pongo abelii GN=BAX (length=741 residues).
atggcgccacggctggcacttatctggagatgctcattggacagtcacgtgacgggaccaagcctcccgagggagcgagg
caggtgcggtcacgtgacccagcggcgctgcggggcagcggccattttgcggggcggccacgtgagggacgcacgttcag
cggggctctcacgtgacccgggcgcgctgcggccgcccgcgcggacccggcgagaggcggcggcgggagcggcggtgatg
gacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgcttca
gggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatgcgt
ccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgcc
gccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactgggg
ccgggttgtcgccctttggacattggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacg
gcctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttcgtggctggagtactcaccgcctcactcacc
atctggaagaagatgggctga
© 1998-2018