Dataset for CDS BAK1 of Organism Pongo abelii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2PIQ6_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pongo abelii GN=BAK1 (length=519 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttacctctgcaacctagctatgagtacttcaccaagattgcctccagcctgttt
gagagtggcatcaactggggccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcgcgg
cctgactggcttcctgggccaggtgacgcgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcac
agaggggtggctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtggttctg
ttgggccagtttgtggtacgaagattcttcaaatcatga
© 1998-2018