Dataset for CDS BAX of Organism Poecilia formosa

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A087XRM1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Poecilia formosa GN=BAX (length=615 residues).
atggcggacgaccgaggggactcggaactagaagacgagctggaaatgcaaggcgctgagggaggaggagatgtctttga
cgaccccatcttggagcagggcgtggtggtgctcagagggtacgtgatagagcgtataagcacggaggatcctggtcgcc
atgtcgactctgtggatctgggaggaaggccacatgaacaagatgacccagaagttaaagaagtggtggatcagctgctg
aaaatagcagacgaactgaacagaaatgtagagttccagcgactgatcaaccaggttcagggaaactgtgcgaaggaagt
cttcatgatggtggccaggagcatctttattgatggcattaactggggccgggtggtggggctctttcatctggcttaca
gactcatatacagggccctcaccaccaaccatctggagaacatcaggatggtgatcagctgggtcctgcaggtcatcagg
gagttgctgtacccctggctggtgcagcaggggggatgggttggtgtcatccaaagctttccatggaggaacgcagccat
agttgcttcaattgttgtagtagcaacatttgtttactacagaatgaaacactga
>gnl|bcl2dbcds|A0A087YA89_BAX-01 BCL2-associated X gene OS=[Eukaryota] Poecilia formosa GN=BAX (length=576 residues).
atggcagaaggaggtggaggtgaccaaggaaattcatctgatcagattgtggaagtcggagctgtgttgttgaaggactt
cattttcgagcggattcggcggcacgtagacagtaatgccatagtgaccagagagcagctcggtgcacaggagctgtgtg
acccaaaccacaagaagctcgctcagtgccttcagcagatcggagacgagctggatggaaacatggagctacaaaagatg
ataaacgactccgccctgagcccgtcaaaagacgtcttcatgaaagttgcctatcagatcttttctgatggtagattcaa
ctggggccgagtggttgcgctcttttacttcgcctgtcgactcgtcataaaagcccttgtaaccaaaattcctgatatca
tcagaacaataattaactggacaatagactacctccgggaccacgtgatcaactggataagagagcaaggtggctgggag
ggaattcgttcctacttcggcactcccacttggcagacattgggggttttcctggccggtgttcttaccactgctttagt
catgcgcaagatgtga
>gnl|bcl2dbcds|A0A096M0U4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Poecilia formosa GN=BAX (length=630 residues).
atgaaaaggtcaaatttatatgcggaaatgttagaaaacaacatggcttcgggaggaaaaggagacgatcaagacacagg
atcttttaaagataccatagtgaaacagctaattgtgttgttaaagaatttcatctggaagcagatcgaaagacgttcac
tgggtaatgctgaaatgattcggaaagtactggacacaccgcagctcaataccccacagatgcaaaaaatctctcggtgt
ctccaggctgttggagatcaagtggatggagatgtacaaagtgcaatgaaagatcaaacaatgcgtccctcattagagaa
ctacatcaaagttgtcctcgggatcttttcagacggtgaaatcaactggggcagggtggttacagtattttcctttacct
gcctatttgttttgaaggcatacgaagacaacatttttgacatgataaaaaacataatcaactggaccgtagattatttc
cggaatacggttgtcaactggatacgagatcaaggtggctgggaggggatttactcttaccttggcactcccacatggca
aacggtggcagtttttctggctggcgttctcaccacccttttcatcacccacaatgcgaggcgtccatga
© 1998-2018