Dataset for CDS Unclassified of Organism Petromyzon marinus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|S4RAT6_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Petromyzon marinus (length=354 residues).
atggacctgctgcgccagtcgtctctgcggctgtcggtcgaggtcctggacgcgctggagcgcggccccggcgagaagca
gctcgtgacgcaggccaaggccctctgccgcgactacatcaactggcggctgctgcgcgcgggcctgggctggggcaagg
ccgagtcgtcggcacactcctgcagcaagttcaccgaggtgtccaacaccgtgctactgctcggtgacgagctggaatac
atgtacccgagcctctaccgcaacgtggacaagcacctgggcctttcggtggcgtctgaggcagccgtgacggaggctct
gcaggccgtggctcacgtcttgttcggcacaggt
© 1998-2018