Dataset for CDS BAX of Organism Petromyzon marinus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|S4RTU5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Petromyzon marinus GN=BAX (length=348 residues).
cgcaggatgatccgcaatatgcccatcgagtctccgcgggagctcttcatgagggtcgccatacagatctttgccgacgg
aaccttcaactggggccgcgtcgttgccctcttctactttgcctatcgccttgtgatgaaggcctacagtagacaactgc
tggacattgtgaagacgatcatcagctgggccgttgactttattcgcgagcacgttatacaatggatccgcgaacaggga
ggatgggagggcgtgcgaacatacttcggctccaacacctggcattcgttgaccatgttcgcggccggagcgctcgtgag
cgccctcgtcttgtggaggataagatga
© 1998-2018