Dataset for CDS BOK of Organism Pelodiscus sinensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|K7FJF5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Pelodiscus sinensis GN=BOK (length=651 residues).
atggaggtgctgcgccgttcctcggtcttcgctgcggaggtgatggaggtgtttgaccggtcgcccaccgacaaggagct
ggtgtcccaggccaaggtgctctgcagagactacatccattcccggctgctccgggccagcctgggctggagcaaagcag
agcacaacgcacccacccctggtggcaggctggctgaggtgtccagcgtgcttctgcagctaggggacgagctggagtac
atccgccccaacgtctatcgcaacgtcgcccgccagctgaacatcgcgctgcactccgagagcgtggtgactgacgcctt
cctggcggtggccgcccagatcttcgcagcaggtaccgagcccgtctgggctggctttgatttatctcttttctctattg
caaggtggtgtgcggtggactgcgtcaggcaggcccagcccgcaatggtgcacatcatcgtggactgcctgggcgagttt
gtccgcaagtccttggtgacgtggctgaaaaggcgaggaggctgggcagacatcacaaagtgcgtggtgaacacggatcc
cagccttcgctcccattggctcgtggctgccatctgtagctttggtcacttccttaaggccgtcttctttgtgctgctgc
cagagagatga
© 1998-2018