Dataset for CDS BAX-like of Organism Pelodiscus sinensis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|K7FJF5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Pelodiscus sinensis GN=BOK (length=651 residues).
atggaggtgctgcgccgttcctcggtcttcgctgcggaggtgatggaggtgtttgaccggtcgcccaccgacaaggagct
ggtgtcccaggccaaggtgctctgcagagactacatccattcccggctgctccgggccagcctgggctggagcaaagcag
agcacaacgcacccacccctggtggcaggctggctgaggtgtccagcgtgcttctgcagctaggggacgagctggagtac
atccgccccaacgtctatcgcaacgtcgcccgccagctgaacatcgcgctgcactccgagagcgtggtgactgacgcctt
cctggcggtggccgcccagatcttcgcagcaggtaccgagcccgtctgggctggctttgatttatctcttttctctattg
caaggtggtgtgcggtggactgcgtcaggcaggcccagcccgcaatggtgcacatcatcgtggactgcctgggcgagttt
gtccgcaagtccttggtgacgtggctgaaaaggcgaggaggctgggcagacatcacaaagtgcgtggtgaacacggatcc
cagccttcgctcccattggctcgtggctgccatctgtagctttggtcacttccttaaggccgtcttctttgtgctgctgc
cagagagatga
>gnl|bcl2dbcds|K7G4J1_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pelodiscus sinensis GN=BAK1 (length=642 residues).
agaagggcttccctcactccggcgcaccccaggggagctgcctgcctgactctgtcagtcgttgtctcttcctcagaaga
tcaagtggcccgtgagacggaggaggtgttccagagctatgccttccaccgctaccagcaagagagggaagcgggcggag
aggaggtgccgatggaccccgagatcgcagagatccagcaggagacgggcagcaccagcagccaggtgggcagacgcctg
gccctcatcggagatgacatcaacatgcggtatgacgcagagttccggaacatgctgaagaccttgcagcccacaaagga
caacgcctacgagtactttaccaagatagcctccagcttgtttgacagcggcattaactggggcagggtgattgcgctgc
tggggttcggttaccggatggcaatccatgtataccagcacgggatgaccggcttcctccggagcattgcccgctacgtg
gcagatttcgtgctccgcaatcgcattgcccagtggattgcccagcagggaggatgggtggcagcattggacttggataa
tgtttatgtgaagtacatgatggtggtgctggtcgtggtcctgctgggtcagttggtggtacggcgctttttcagctcgt
ga
© 1998-2018