Dataset for CDS BAX-like of Organism Papio anubis

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A2I3LG80_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Papio anubis GN=BAK1 (length=567 residues).
atggcatcagggcaaggcccagggtttcccaggcaggagtgcggagagcttgccctgccctctgcttctgaggagcaggt
aacccgggacatggagaaggtttttgaccgccatcagcaggaacaggaagctgaaggcagcaccgtggggcaggtgggac
ggcagatcgccatcatctgggatgacatcaatcggcgctatgactcggagttccagaccatgctgcagcacctgcagccc
acagcagagaacgcctacgagtacttcaccaagatcgcctccagcctgtttgagagtggcatcaaccagggccgtgtggt
ggctctcctgggcttcggctaccgtctggccctacatgtctaccagcgcggcttgactggcttcctgggccaggtgaccc
gcttcgtggtcttcatgctgcaacactgcatcgcctggtggatcgcgcagaggggcagctgggtggcagccctggacttg
ggcaatggtcccatcctgaacatgctggtgattctgggggtggttctgttgggcccgtttgtggtacaaagattcttcaa
atcatga
>gnl|bcl2dbcds|A0A2I3LG80_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Papio anubis GN=BAK1 (length=627 residues).
atggcatcagggcaaggcccagggtttcccaggcaggagtgcggagagcttgccctgccctctgcttctgaggagcaggt
aacccgggacatggagaaggtttttgaccgccatcagcaggaacaggaagctgaagggccagccgcccctgccgacccag
agatggtcaccttgcccctccaacctagcagcaccgtggggcaggtgggacggcagatcgccatcatctgggatgacatc
aatcggcgctatgactcggagttccagaccatgctgcagcacctgcagcccacagcagagaacgcctacgagtacttcac
caagatcgcctccagcctgtttgagagtggcatcaaccagggccgtgtggtggctctcctgggcttcggctaccgtctgg
ccctacatgtctaccagcgcggcttgactggcttcctgggccaggtgacccgcttcgtggtcttcatgctgcaacactgc
atcgcctggtggatcgcgcagaggggcagctgggtgtcaagtctgaaaaacctgcacatccctccctctccagcctcccc
gcctcatccattccccagggatgattcttttacctgcttcaatgctattgttgagcaacttctataa
>gnl|bcl2dbcds|A0A2I3LYL4_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Papio anubis GN=BOK (length=639 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggatgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctactgcgcgccggcctctcctggagcgcgcccg
agcgcgccgcgcctgtcccgggacgcctggccgaggtgtgcgcggtgctcctgcgcctgggggatgagctggagatgatc
cggcccagcgtctaccgcaacgtggctcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcct
ggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggctgg
ccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctgggggagtttgtgcgcaagacc
ctggcaacctggctgcggagacgcggcggatggactgatgtcctcaagtgtgtggtcagcacagaccctggcctccgctc
ccactggctggtagccgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
>gnl|bcl2dbcds|A0A2I3MLN0_BAX-04 BCL2-associated X gene OS=[Eukaryota] Papio anubis GN=BAX (length=609 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
ctcctcaaccctcctcaccccaaccaccgcccctgccccactgtccctgcccacccccggtcacagtggtgccctctccc
catctttggatcatcagatgtggtctataatgcatttccttatgtgtct
>gnl|bcl2dbcds|A0A2I3MLN0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Papio anubis GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaggctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
gaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2I3MLN0_BAX-02 BCL2-associated X gene OS=[Eukaryota] Papio anubis GN=BAX (length=552 residues).
atggacgggtccggggagcagcccagaggcggggtgacaccccgttctgattctgcaccctcactccatccccactctag
gcgaatggggggggagacacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaggctgagcgagtgtc
tcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgccgccgtggacacagactccccccga
gaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactggggccgtgttgtcgcccttttctactt
tgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatcagaaccatcatgggctggacactggact
tcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggcctcctctcctactttgggacgcccacg
tggcagaccgtgaccatcttggtggctggagtactcaccgcctccctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2I3MLN0_BAX-03 BCL2-associated X gene OS=[Eukaryota] Papio anubis GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgtgttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtg
cccgaactgatcagaaccatcatgggctggacactggacttcctccgggagcggctgttgggctggatccaagaccaggg
tggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatcttggtggctggagtactcaccg
cctccctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2I3MUA8_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Papio anubis GN=BAK1 (length=636 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggagcaggaggctgaaggggcggctg
cccctgctgatccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcagctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
ttggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2I3MUA8_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Papio anubis GN=BAK1 (length=462 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggagcaggaggctgaaggggcggctg
cccctgctgatccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgctgcagcagctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
tgtggtggctcttctgggctttggctaccgtctggccctacacgtctaccagcacggcctga
© 1998-2018