Dataset for CDS BOK of Organism Pan troglodytes

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2REG3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Pan troglodytes GN=BOK (length=621 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccacagacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctgctgcgcgccggcctctcctggagcgcgcccg
agcgtgccgcgccggtcccgggacgcctggctgaggtgtgcgcggtgctgctgcgcctgggcgatgagctggagatgatc
cggcccagcgtctaccgcaacgtggcgcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcct
ggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggctgg
ccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctgggggagttcgtgcgcaagacc
ctggcaacctggcttcggagacgcggcggatggacggatgtcctcaagtgtgtggtcagcacagacccctggcctccctc
ccactggctggtagctgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtc
© 1998-2018