Dataset for CDS BAX-like of Organism Pan troglodytes

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A2I3SNH6_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pan troglodytes GN=BAK1 (length=597 residues).
atggcatcggggcaaggcccagggcctcccaggcaggagtgcggaaagcctgccctgccctctgcttctgaggactacgt
tttttaccaccatcagcaggaacaggaggctgaaggggcggccgcccctgccaacccagagatggtcaccttgcccctcc
aacctagcagcaccatggggcaggtgggacggcagctcgccatcaccaggatgacatcaaccggcactatgacttcggag
ttccagaccatgctgcagcacctgcagcccacggcagagaacgcctacgagtacttcaccaagatcgcctccagcctgtt
tgagagtggcatcaaccagggccgtgtggtggctctcctgggcttcggctaccgtctggtcctacatgtctaccagcaca
gcttgactggcttcctgggcctggtgacccgcttcgtggtcttcatgctgcaacacggcatcacccagtggatctcgcag
aggggcggctgggtggcagccctggacttgggcaatagtcccatcctgaacgtgctggtggttgtgggtgtggttctgct
gggccagtttgtggtaagaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2I3T6V0_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pan troglodytes GN=BAK1 (length=462 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctgcagcccacggcagagaatgc
ctatgagtacttcaccaagattgccaccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcatggcctga
>gnl|bcl2dbcds|A0A2I3T6V0_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pan troglodytes GN=BAK1 (length=579 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcagaacccctctgccatgagccagggcc
tggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcac
ctgcagcccacggcagagaatgcctatgagtacttcaccaagattgccaccagcctgtttgagagtggcatcaactgggg
ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcatggcctgactggcttcctgggcc
aggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggca
gccctgaacttgggcaatggtcccatcctgaacgtgctggtagttctgggtgtggttctgttgggccagtttgtggtacg
aagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2I3T6V0_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pan troglodytes GN=BAK1 (length=636 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctgcagcccacggcagagaatgc
ctatgagtacttcaccaagattgccaccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcatggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtagttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2I3TUX1_BAX-03 BCL2-associated X gene OS=[Eukaryota] Pan troglodytes GN=BAX (length=222 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaag
>gnl|bcl2dbcds|A0A2I3TUX1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Pan troglodytes GN=BAX (length=369 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatgaggggggaggcacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaag
>gnl|bcl2dbcds|A0A2I3TUX1_BAX-02 BCL2-associated X gene OS=[Eukaryota] Pan troglodytes GN=BAX (length=303 residues).
atggacgggtccggggagcatttcatccaggatcgagcagggcgaatgaggggggaggcacccgagctggccctggaccc
ggtgcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagc
tgcagaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgac
ggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaag
>gnl|bcl2dbcds|H2REG3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Pan troglodytes GN=BOK (length=621 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccacagacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctgctgcgcgccggcctctcctggagcgcgcccg
agcgtgccgcgccggtcccgggacgcctggctgaggtgtgcgcggtgctgctgcgcctgggcgatgagctggagatgatc
cggcccagcgtctaccgcaacgtggcgcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcct
ggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggctgg
ccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctgggggagttcgtgcgcaagacc
ctggcaacctggcttcggagacgcggcggatggacggatgtcctcaagtgtgtggtcagcacagacccctggcctccctc
ccactggctggtagctgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtc
© 1998-2018