Dataset for CDS BAX of Organism Pan troglodytes

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A2I3TUX1_BAX-03 BCL2-associated X gene OS=[Eukaryota] Pan troglodytes GN=BAX (length=222 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaag
>gnl|bcl2dbcds|A0A2I3TUX1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Pan troglodytes GN=BAX (length=369 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatgaggggggaggcacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaag
>gnl|bcl2dbcds|A0A2I3TUX1_BAX-02 BCL2-associated X gene OS=[Eukaryota] Pan troglodytes GN=BAX (length=303 residues).
atggacgggtccggggagcatttcatccaggatcgagcagggcgaatgaggggggaggcacccgagctggccctggaccc
ggtgcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagc
tgcagaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgac
ggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaag
© 1998-2018