Dataset for CDS BAX-like of Organism Pan paniscus

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A2R8ZTH2_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pan paniscus GN=BAK1 (length=579 residues).
atggcatcagggcaaggcccagggcctcccaggcaggagtgcggaaagcctgccctgccctctgcttctgaggagcaggt
agcccaggacatggaggggttttccgcagctacgtttttttaccaccatcagcaggaacaggaggctgaaggggcggccg
cccctgccaacccagagatggtcaccttgcccctccaacctagcagcaccatggggcaggtgggacggcagctcgccatc
accaggacgacatcaaccggcactatgacttcggagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctacgagtacttcaccaagatcgcctccagcctgtttgagagtggcatcaaccggggccgtgtggtggctctcctgggct
tcggctaccgtctggtcctacatgtctaccagcatggcttgactggcttcctgggcctggtgacccgcttcgtggtcttc
atgctgcaacacggcatcgcccagtggatctcgcagaggggcggctgggtggcagccctggacttggcaccgccttcacc
actgccccatcctggctga
>gnl|bcl2dbcds|A0A2R9A7S4_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pan paniscus GN=BAK1 (length=636 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctgcagcccacggcagagaatgc
ctatgagtacttcaccaagattgccaccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcatggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtagttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2R9A7S4_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pan paniscus GN=BAK1 (length=462 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctgcagcccacggcagagaatgc
ctatgagtacttcaccaagattgccaccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcatggcctga
>gnl|bcl2dbcds|A0A2R9A7S4_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pan paniscus GN=BAK1 (length=579 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcagaacccctctgccatgagccagggcc
tggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcac
ctgcagcccacggcagagaatgcctatgagtacttcaccaagattgccaccagcctgtttgagagtggcatcaactgggg
ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcatggcctgactggcttcctgggcc
aggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggca
gccctgaacttgggcaatggtcccatcctgaacgtgctggtagttctgggtgtggttctgttgggccagtttgtggtacg
aagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2R9BX16_BAX-03 BCL2-associated X gene OS=[Eukaryota] Pan paniscus GN=BAX (length=609 residues).
atggacgggtccggggagcagcccagaggcgggggtgaggatcgagcagggcgaatggggggggaggcacccgagctggc
cctggacccggtgcctcaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagta
acatggagctgcagaggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatg
ttttctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtg
caccaaggtgccggaactgatcagaaccatcatgggctggacattggacttcctccgggagcggctgttgggctggatcc
aagaccagggtggttgggggctgcccctggccgagtcactgaagcgactgatgtccctgtctccaggacggcctcctctc
ctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccatctggaaga
agatgggctgaggcccccagctgccttggactgtgtttttcctccataa
>gnl|bcl2dbcds|A0A2R9BX16_BAX-02 BCL2-associated X gene OS=[Eukaryota] Pan paniscus GN=BAX (length=642 residues).
atggacgggtccggggagcagcccagaggcgggggagtgacaccccgttctgattctgcaccctcactccatccccactc
taggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatgcgtccaccaagaagctgagcgagt
gtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgattgccgccgtggacacagactccccc
cgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactggggccgggttgtcgcccttttcta
ctttgccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatcagaaccatcatgggctggacattgg
acttcctccgggagcggctgttgggctggatccaagaccagggtggttgggggctgcccctggccgagtcactgaagcga
ctgatgtccctgtctccaggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgg
gagtgctcaccgcctcactcaccatctggaagaagatgggctgaggcccccagctgccttggactgtgtttttcctccat
aa
>gnl|bcl2dbcds|A0A2R9BX16_BAX-01 BCL2-associated X gene OS=[Eukaryota] Pan paniscus GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatca
gaaccatcatgggctggacattggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggacggc
ctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccgcctcactcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2R9BX16_BAX-05 BCL2-associated X gene OS=[Eukaryota] Pan paniscus GN=BAX (length=657 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggaggcacccgagctggccctggacccggtgcctcaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagtaacatggagctgcagaggatgatt
gccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgccggaactgatca
gaaccatcatgggctggacattggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
ctcctcaagcctcctcacccccaccaccgcgccctcaccactgcccctgccccaccgtccctgccccccgccactcctct
gggaccctgggccttctggagcaggtcacagtggtgccctctccccatcttcagatcatcagatgtggtctataatgcgt
tttccttacatgtctga
>gnl|bcl2dbcds|A0A2R9BX16_BAX-04 BCL2-associated X gene OS=[Eukaryota] Pan paniscus GN=BAX (length=432 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgattgccgccgtggacacagactccccccgagaggtctttttccgagtggcagctgacatgttttctgacg
gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtg
ccggaactgatcagaaccatcatgggctggacattggacttcctccgggagcggctgttgggctggatccaagaccaggg
tggttgggacggcctcctctcctactttgggacgcccacgtggcagaccgtgaccatctttgtggcgggagtgctcaccg
cctcactcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A2R9CGU2_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Pan paniscus GN=BOK (length=639 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccacagacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctgctgcgcgccggcctctcctggagcgcgcccg
agcgtgccgcgccggtcccgggacgcctggctgaggtgtgcgcggtgctgctgcgcctgggcgatgagctggagatgatc
cggcccagcgtctaccgcaacgtggcgcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcct
ggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggctgg
ccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctgggggagttcgtgcgcaagacc
ctggcaacctggcttcggagacgcggcggatggacggatgtcctcaagtgtgtggtcagcacagaccctggcctccgctc
ccactggctggtagctgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagagagatga
© 1998-2018