Dataset for CDS BAK1 of Organism Pan paniscus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A2R8ZTH2_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pan paniscus GN=BAK1 (length=579 residues).
atggcatcagggcaaggcccagggcctcccaggcaggagtgcggaaagcctgccctgccctctgcttctgaggagcaggt
agcccaggacatggaggggttttccgcagctacgtttttttaccaccatcagcaggaacaggaggctgaaggggcggccg
cccctgccaacccagagatggtcaccttgcccctccaacctagcagcaccatggggcaggtgggacggcagctcgccatc
accaggacgacatcaaccggcactatgacttcggagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctacgagtacttcaccaagatcgcctccagcctgtttgagagtggcatcaaccggggccgtgtggtggctctcctgggct
tcggctaccgtctggtcctacatgtctaccagcatggcttgactggcttcctgggcctggtgacccgcttcgtggtcttc
atgctgcaacacggcatcgcccagtggatctcgcagaggggcggctgggtggcagccctggacttggcaccgccttcacc
actgccccatcctggctga
>gnl|bcl2dbcds|A0A2R9A7S4_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pan paniscus GN=BAK1 (length=636 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctgcagcccacggcagagaatgc
ctatgagtacttcaccaagattgccaccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcatggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtagttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A2R9A7S4_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pan paniscus GN=BAK1 (length=462 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggtcaccttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatc
atcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctgcagcccacggcagagaatgc
ctatgagtacttcaccaagattgccaccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcatggcctga
>gnl|bcl2dbcds|A0A2R9A7S4_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Pan paniscus GN=BAK1 (length=579 residues).
atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcagaacccctctgccatgagccagggcc
tggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcac
ctgcagcccacggcagagaatgcctatgagtacttcaccaagattgccaccagcctgtttgagagtggcatcaactgggg
ccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcatggcctgactggcttcctgggcc
aggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggca
gccctgaacttgggcaatggtcccatcctgaacgtgctggtagttctgggtgtggttctgttgggccagtttgtggtacg
aagattcttcaaatcatga
© 1998-2018