Dataset for CDS BOK of Organism Ovis aries

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5Q896_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Ovis aries GN=BOK (length=519 residues).
ctcggccgcgagttcgtgcacgcgcggctgctacgcgctggcctctcctggagcgcgcccgagcgcgccgcgccggtccc
cggcggccgcctggcggaggtgtgcgccgtgctgctgcgcctggcagcggacgagctggagctgatccggcccagcgtct
accgcaacgtggcccgccagctgaacctctccttgcagtcggagaccgtggtgaccgacgccttcctggccgtggcgacc
cagatcttctctgcaggcatcacgtggggcaaggttgtgtctctgtactcggtggccgcggggctggccggggactgtgt
gcggcaggccccggcgtgggacacgggcagctccgtcccctgcctgtcctgtcctcgggcccggcggggctggacagacg
tgctcaagtgtgtggtcagcaccgacccaggcctgcgctctcactggctggtggccgcgctctgcagctttggccgcttc
ctgaaggctgccttcttcatgctgttgccggagagatga
© 1998-2018