Dataset for CDS BAX-like of Organism Ovis aries

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|W5PK25_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ovis aries GN=BAK1 (length=636 residues).
atggcttcgggacaaggtccaggtccccctgggcagggctgcgatgagcctgaaccctcctccgcatcggaggagcaggt
agcccgggataccgaggaggtcttccgcagctacgtcttttaccgccatcagcaggagcaggaggccgagggggcggctg
cgcctactgacccagagatggtcaccttgcacccagagcctaccagtcctgatcctccagcaccatgggagctcgccgtc
atcggggatgacatcaaccggcgctacgacacagagttccaggccatgctgcagcacctgcagccgacggcagacaacgc
ctacgagtacttcaccaagatcgcgtccagcctgtttgagagcggcatcaactggggccgcgtggtggctctgctgggtt
acggcttccgcctggccctccacgtctaccagcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
ttcgtgctgcgtcgctccatcgcccggtggatcgcacagaggggtggctgggtggcagccctggacttggggaacgcccc
catcaagaacgtagccatagttctggctgtggttttgttgggccagtttgtggtacgaagattcttcaagtcatga
>gnl|bcl2dbcds|W5PSA7_BAX-01 BCL2-associated X gene OS=[Eukaryota] Ovis aries GN=BAX (length=585 residues).
acccggcgagaggcggtgaggcgggaggcagacgggcgggggcccaccagctctgagcagatcatgaagacaggggccct
tttgcttcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgcccc
aggatgcatccaccaagaagctgagcgagtgtctgaagcgcattggagatgaattggacagtaacatggagctgcagagg
atgatcgcagccgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttccgacggcaactt
caactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagt
tgatcaggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgg
gacggcctcctctcctactttgggacacccacatggcagacggtgaccatctttgtggctggagtgctcactgcctcact
caccatctggaagaagatgggctga
>gnl|bcl2dbcds|W5Q896_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Ovis aries GN=BOK (length=519 residues).
ctcggccgcgagttcgtgcacgcgcggctgctacgcgctggcctctcctggagcgcgcccgagcgcgccgcgccggtccc
cggcggccgcctggcggaggtgtgcgccgtgctgctgcgcctggcagcggacgagctggagctgatccggcccagcgtct
accgcaacgtggcccgccagctgaacctctccttgcagtcggagaccgtggtgaccgacgccttcctggccgtggcgacc
cagatcttctctgcaggcatcacgtggggcaaggttgtgtctctgtactcggtggccgcggggctggccggggactgtgt
gcggcaggccccggcgtgggacacgggcagctccgtcccctgcctgtcctgtcctcgggcccggcggggctggacagacg
tgctcaagtgtgtggtcagcaccgacccaggcctgcgctctcactggctggtggccgcgctctgcagctttggccgcttc
ctgaaggctgccttcttcatgctgttgccggagagatga
© 1998-2018