Dataset for CDS BAK1 of Organism Ovis aries

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5PK25_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ovis aries GN=BAK1 (length=636 residues).
atggcttcgggacaaggtccaggtccccctgggcagggctgcgatgagcctgaaccctcctccgcatcggaggagcaggt
agcccgggataccgaggaggtcttccgcagctacgtcttttaccgccatcagcaggagcaggaggccgagggggcggctg
cgcctactgacccagagatggtcaccttgcacccagagcctaccagtcctgatcctccagcaccatgggagctcgccgtc
atcggggatgacatcaaccggcgctacgacacagagttccaggccatgctgcagcacctgcagccgacggcagacaacgc
ctacgagtacttcaccaagatcgcgtccagcctgtttgagagcggcatcaactggggccgcgtggtggctctgctgggtt
acggcttccgcctggccctccacgtctaccagcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
ttcgtgctgcgtcgctccatcgcccggtggatcgcacagaggggtggctgggtggcagccctggacttggggaacgcccc
catcaagaacgtagccatagttctggctgtggttttgttgggccagtttgtggtacgaagattcttcaagtcatga
© 1998-2018