Dataset for CDS BOK of Organism Otolemur garnettii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H0XQN5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Otolemur garnettii GN=BOK (length=642 residues).
atggagatgctgcggcgctcttcagtcctcgccgcggagatcatggatgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctgggcagggagttcgtgcacgctcggctgctgcgcgctggcctcgcctggagcgcgcctg
agcgcgctgcgctggtccttggcggccgcctggcagaggtgtgcactgtgctgctgcgcttgggggatgagctggagctg
atacggcccggtgtctaccgcaacgtggctcgccagctgcacatctccctgcagtctgagcctgtggtgaccgacgcatt
tctggctgtggcaggccacatattctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcagtggctgcagggc
tggcagtggactgtgtgcggcaggctcagcctgccatggtccatgcccttgttgactgcttgggggaatttgtgcgcaag
accctggcagcctggctgcggaggcgcggtggatggacagacgtcctaaagtgtgtggtcagtacggacccaggcctccg
ctcccactggcttgtggcaacgctctgcagcttcggtcgcttcctgaaggctgccttcttcgtgcttttgccagagagat
ga
© 1998-2018