Dataset for CDS BAX-like of Organism Otolemur garnettii

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|H0XDK0_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Otolemur garnettii GN=BAK1 (length=636 residues).
atggcatccgggcaaggcccaggtcctcctgggcaggagtgtggagagtccacccagccttccatatctgaggagcaggt
agcccgggacacagaggaagtcttccgcagctacgttttttaccgccatcagcaggagcaggaggctgagggggcagctg
cccctgctgacccagagatggtcaccttgcctctagaacccagcagcactatggggcaggtgggtcggcagcttgccatc
atcggggatgacatcaaccggcgctatgactcagagttccagaccatgctgcagcacttgcagcccacagcagagaacgc
ctatgagtatttcatcaagatcgcctcaagcctgtttgagagtggcatcaactggggccgtgtggtggctctcctgggtt
tcggctaccgcctggccatccatgtttaccagcgcggcctgactggcttcctgggccaggtgactcgcttcgtggtcgac
ttcatgctgcatcactgcattgcccggtggatcgcgcagaggggcggctgggtggcggccctggacttgggcaacggccc
catccgtaatgtactgatggttctggctgtggttctgttgggccagtttgtggtacgaagattcttcaagtcatga
>gnl|bcl2dbcds|H0XH75_BAX-01 BCL2-associated X gene OS=[Eukaryota] Otolemur garnettii GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacctgagctggccctggagccgacgccccaggatg
catccaccaagaagctaagcgagtgtctcaaacgcatcggggatgaactggacagtaacatggagctgcagaggatgatt
gctgctgtggacacagactccccccgtgaggtttttttccgagtggcagctgagatgttttctgatggcaacttcaactg
gggccgggttgtggccctcttctactttgcaagcaaactggtgctcaaggccctgtgcacgaaggtccctgagctgatca
gaactatcatgggctggacattggacttcctccgagagcgactgctgggctggatccaagaccagggtggttgggacggc
ctcctttcctactttggaacccctacgtggcagacagtgaccatctttgtggctggagtgcttactgcctcgctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|H0XQN5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Otolemur garnettii GN=BOK (length=642 residues).
atggagatgctgcggcgctcttcagtcctcgccgcggagatcatggatgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctgggcagggagttcgtgcacgctcggctgctgcgcgctggcctcgcctggagcgcgcctg
agcgcgctgcgctggtccttggcggccgcctggcagaggtgtgcactgtgctgctgcgcttgggggatgagctggagctg
atacggcccggtgtctaccgcaacgtggctcgccagctgcacatctccctgcagtctgagcctgtggtgaccgacgcatt
tctggctgtggcaggccacatattctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcagtggctgcagggc
tggcagtggactgtgtgcggcaggctcagcctgccatggtccatgcccttgttgactgcttgggggaatttgtgcgcaag
accctggcagcctggctgcggaggcgcggtggatggacagacgtcctaaagtgtgtggtcagtacggacccaggcctccg
ctcccactggcttgtggcaacgctctgcagcttcggtcgcttcctgaaggctgccttcttcgtgcttttgccagagagat
ga
© 1998-2018