Dataset for CDS BAX of Organism Otolemur garnettii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H0XH75_BAX-01 BCL2-associated X gene OS=[Eukaryota] Otolemur garnettii GN=BAX (length=579 residues).
atggacgggtccggggagcagcccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggggagacacctgagctggccctggagccgacgccccaggatg
catccaccaagaagctaagcgagtgtctcaaacgcatcggggatgaactggacagtaacatggagctgcagaggatgatt
gctgctgtggacacagactccccccgtgaggtttttttccgagtggcagctgagatgttttctgatggcaacttcaactg
gggccgggttgtggccctcttctactttgcaagcaaactggtgctcaaggccctgtgcacgaaggtccctgagctgatca
gaactatcatgggctggacattggacttcctccgagagcgactgctgggctggatccaagaccagggtggttgggacggc
ctcctttcctactttggaacccctacgtggcagacagtgaccatctttgtggctggagtgcttactgcctcgctcaccat
ctggaagaagatgggctga
© 1998-2018