Dataset for CDS BAX-like of Organism Oryzias latipes

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A3B3I8J4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Oryzias latipes GN=BAX (length=882 residues).
atgcaacatgattccatcaaaaggatggcgcgcgcgccgcccggtttccggttaaggtgtgcgtgtctgagacgctgcag
atcaaggctggccccgctggccctgccccgccgcggcccggcccggccccgctggtcctcacgggacttccgcgttcaac
taaaaacgctcgacattagccgcggacaccgcgtcttccacggcggctttactgaaccggactctaaagttggaggcaga
agtcggacttctccgtcatctgggtccatggctgacggcgggggggaggacagggcggagggcgcggagccgcggggcgc
cgagggcggggaagatgtttttgatgatcccatcttggagcaaggagcggtggtcctcagagggtacgtgattgaaagga
taaacttacaggaccctgatttatacgtgtcgtctgaggatctgggaggaagtccaaacgaacaagaagatccacaaatc
aaagaagtggtggagcagctgctcaagatagcagatgacatcaacaggaatgctgtgctacagcaattgatcaaccaggc
gtctggtagcggtgcacaggacatcttcatggaagtggccaggagcatctttgctgatgggatcaactggggtcgagtgg
tggctctctttcacctggcctacaaattcatatacaaggcactgaccagcaaccatctagagaccatcagaatgataatc
agctgggtactgcaagtcatcaaagaagtgctctatccctggctggtgcagcagggaggttgggtgggcgttatccaacg
tttttcacgctggagaacattgaccgttgcagcgtcaatagtattgcttgcagcctttgtttactacaggaagacgcgct
ga
>gnl|bcl2dbcds|A0A3B3ID71_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Oryzias latipes GN=BOK (length=633 residues).
atggagatgctgcgccgctcctccgtgtttgcggccgaagtcttcgaccgctcccccactgacaaggagctggtgtcgca
ggccaaagcgctgtgcagagagtacatccactccaggctgaaccgagccggcatcggttggtccaaacccgagcacgcgc
aggctggcgcaggcggtgcgctcggggaggtgtcttcggtcctcctgtggttgggcgaggagctggagtaccttcggccc
aatgtgtacaggaacgtcgctcgccagctgaacatcaccgtggcgtcagagagcatcgtgtcggacgccttcctggctgt
ggccgcagacatcttctccactggtatcacgtgggggaaggtggtttccttgtatgcggtggcaggggctctggctgtgg
actgcgtccgccacggtcacccggcaatggtccacaccattgtggactgcatgggggagtttgcccgcaagagtctgacc
gtgtggttgaaaaagagaggaggctgggtggacatgaccaaatgtgtggtgaacacggaccccagcttccactcccactg
gctgctggctgccgtctgcgccttcggacactacctgaaggctgttgtgctgcacctcctcagagagaaatga
>gnl|bcl2dbcds|H2LIC3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Oryzias latipes GN=BAX (length=567 residues).
atggcatcgcaccccggaggaggcgatcaagaaaaatccaaagagctactggatgtgggcaccaagttgctgaagaactt
catctgtgaacgggtcaggagaaacctgcaggatgactctgaagtggtcagacagcagctgggtgcagaggagctggttg
acccaaaccacaagagacttgctcaatgcctccagcagattggagatgagctggatgggaatgtagagctcaaaagattg
attgatgactcttcgctcagtccctccaaagaagtgtttctaaaagtggccctcgagattttttctgatggggtatacaa
ctggggccgggtggttacacttttctacttcgcctgtcggctggtcataaaggctctcatcacaaaagtaccagacatca
ttagaactatattcacctggaccatagattaccttcgggattatgtgattgcctggataagagagcaaggcggctgggat
ggcatctttggcactcctggctggcagacgttggccgtctttgttgcaggcgttctcaccgctgcggtggtcattcgcaa
gatgtga
>gnl|bcl2dbcds|H2MP81_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Oryzias latipes GN=BOK (length=642 residues).
atggatgttctgaggcgttcctctgtttttgcggctgaggtcctggatgtgtttgagcgatcgctgtctgagaaggagct
ggtgacccagtcgaaagcgttgtgcagagactacatcctgtccagactccaccaaaatgggatggggtggtccaaagccg
aaattaatttctctccctccaatgcggcactctccgaggtgactatggttcttctgtgtctaggagacgagctggagtgc
atacagcctggtctgtacaggaacgtagcacggcagctcaacatttctgttgccatggagaacgtggtttcagatgcctt
ccttggtgtggcaacagaaattttctcagcaggtataacatggggcaaggtggtgtccatgtatgcagtagctggagccc
tggctgtggattgtgtcagacaaggttacctcaccaccgtgcacatcttggtggacagccttgggcagtttgttcgcaaa
ttcctggttcactggttaaaaaggagaggaggatgggctgagatcaccaaatgcgtggtgaagaaggagctcacctcaga
gcagccctggttgtcctccatcatggagtctgtcaagtacgctctcactacgctgtacgtctacgtcatgaaggaaacgt
ga
© 1998-2019