Dataset for CDS BAX-like of Organism Oryzias latipes

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|H2L9U3_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Oryzias latipes GN=BOK (length=681 residues).
ttggaaagcatgagggcctgtggggttgccagagtgaatcccgctcaggccttcagccgctcagcccccactgacaagga
gctggtgtcgcaggccaaagcgctgtgcagagagtacatccactccaggctgaaccgagccggcatcggttggtccaaac
ccgagcacgcgcaggctggcgcaggcggtgcgctcggggaggtgtcttcggtcctcctgtggttgggcgaggagctggag
taccttcggcccaatgtgtacaggaacgtcgctcgccagctgaacatcaccgtggcgtcagagagcatcgtgtcggacgc
cttcctggctgtggccgcagacatcttctccactggaagaattagtgaaaaacagaatcactgccacaaacgtatcacgt
gggggaaggtggtttccttgtatgcggtggcaggggctctggctgtggactgcgtccgccacggtcacccggcaatggtc
cacaccattgtggactgcatgggggagtttgcccgcaagagtctgaccgtgtggttgaaaaagagaggaggctgggtgga
catgaccaaatgtgtggtgaacacggaccccagcttccactcccactggctgctggctgccgtctgcgccttcggacact
acctgaaggctgttgtgctgcacctcctcagagagaaatga
>gnl|bcl2dbcds|H2LIC3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Oryzias latipes GN=BAX (length=567 residues).
atggcatcgcaccccggaggaggcgatcaagaaaaatccaaagagctactggatgtgggcaccaagttgctgaagaactt
catctgtgaacgggtcaggagaaacctgcaggatgactctgaagtggtcagacagcagctgggtgcagaggagctggttg
acccaaaccacaagagacttgctcaatgcctccagcagattggagatgagctggatgggaatgtagagctcaaaagattg
attgatgactcttcgctcagtccctccaaagaagtgtttctaaaagtggccctcgagattttttctgatggggtatacaa
ctggggccgggtggttacacttttctacttcgcctgtcggctggtcataaaggctctcatcacaaaagtaccagacatca
ttagaactatattcacctggaccatagattaccttcgggattatgtgattgcctggataagagagcaaggcggctgggat
ggcatctttggcactcctggctggcagacgttggccgtctttgttgcaggcgttctcaccgctgcggtggtcattcgcaa
gatgtga
>gnl|bcl2dbcds|H2MP80_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Oryzias latipes GN=BOK (length=642 residues).
atggatgttctgaggcgttcctctgtttttgcggctgaggtcctggatgtgtttgagcgatcgctgtctgagaaggagct
ggtgacccagtcgaaagcgttgtgcagagactacatcctgtccagactccaccaaaatgggatggggtggtccaaagccg
aaattaatttctctccctccaatgcggcactctccgaggtgactatggttcttctgtgtctaggagacgagctggagtgc
atacagcctggtctgtacaggaacgtagcacggcagctcaacatttctgttgccatggagaacgtggtttcagatgcctt
ccttggtgtggcaacagaaattttctcagcaggtataacatggggcaaggtggtgtccatgtatgcagtagctggagccc
tggctgtggattgtgtcagacaaggttacctcaccaccgtgcacatcttggtggacagccttgggcagtttgttcgcaaa
ttcctggttcactggttaaaaaggagaggaggatgggctgagatcaccaaatgcgtggtgaagaaggagctcacctcaga
gcagccctggttgtcctccatcatggagtctgtcaagtacgctctcactacgctgtacgtctacgtcatgaaggaaacgt
ga
>gnl|bcl2dbcds|H2MP80_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Oryzias latipes GN=BOK (length=675 residues).
atggatgttctgaggcgttcctctgtttttgcggctgaggtcctggatgtgtttgagcgatcgctgtctgagaaggagct
ggtgacccagtcgaaagcgttgtgcagagactacatcctgtccagactccaccaaaatgggatggggtggtccaaagccg
aaattaatttctctccctccaatgcggcactctccgaggtgactatggttcttctgtgtctaggagacgagctggagtgc
atacagcctggtctgtacaggaacgtagcacggcagctcaacatttctgttgccatggagaacgtggtttcagatgcctt
ccttggtgtggcaacagaaattttctcagcagttttttcagccaaaacccaacagacagactccattataacatggggca
aggtggtgtccatgtatgcagtagctggagccctggctgtggattgtgtcagacaaggttacctcaccaccgtgcacatc
ttggtggacagccttgggcagtttgttcgcaaattcctggttcactggttaaaaaggagaggaggatgggctgagatcac
caaatgcgtggtgaagaaggagctcacctcagagcagccctggttgtcctccatcatggagtctgtcaagtacgctctca
ctacgctgtacgtctacgtcatgaaggaaacgtga
© 1998-2018