Dataset for CDS BAX of Organism Oryzias latipes

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2LIC3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Oryzias latipes GN=BAX (length=567 residues).
atggcatcgcaccccggaggaggcgatcaagaaaaatccaaagagctactggatgtgggcaccaagttgctgaagaactt
catctgtgaacgggtcaggagaaacctgcaggatgactctgaagtggtcagacagcagctgggtgcagaggagctggttg
acccaaaccacaagagacttgctcaatgcctccagcagattggagatgagctggatgggaatgtagagctcaaaagattg
attgatgactcttcgctcagtccctccaaagaagtgtttctaaaagtggccctcgagattttttctgatggggtatacaa
ctggggccgggtggttacacttttctacttcgcctgtcggctggtcataaaggctctcatcacaaaagtaccagacatca
ttagaactatattcacctggaccatagattaccttcgggattatgtgattgcctggataagagagcaaggcggctgggat
ggcatctttggcactcctggctggcagacgttggccgtctttgttgcaggcgttctcaccgctgcggtggtcattcgcaa
gatgtga
© 1998-2018