Dataset for CDS BOK of Organism Oryctolagus cuniculus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1TXB3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Oryctolagus cuniculus GN=BOK (length=417 residues).
gacgagttggagctgattcggcccagtgtctaccgcaacgtggcccgccagctccacatctccctgcagtccgagcccgt
ggtgaccgacgcgttcctggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatg
ctgtggccgcagggctggccgtggactgcgtgcggcaggcccagcccgccatggtccacgccctggttgactgcctgggg
gagtttgtgcggaagaccctggccacctggctgcggcggcgcggcggatggaccgacgtgctcaagtgtgtggtcagcac
ggaccctggcctccgctcccactggctcctggctgcgctctgcagcctcggccgcttcctcaaggcggctgtctttgtgc
tgttgccggagagatga
© 1998-2018