Dataset for CDS BAX-like of Organism Oryctolagus cuniculus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|G1SHS9_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BAK1 (length=633 residues).
atggcatccgggcaaggcccaggtcctcctggcgaaggctgtggagagcctcccgagccctccacttctgagcagcaggt
agcccgggacacggaggaggttttccgcagctacgttttccaccgccaccggcaggagcaggaggccgagggggcggctg
cccctgctgacccggagatgatctccttgcacctggaacctaacagcaccatggggcaggtggggcggcagctcgccatc
attggggacgacatcaaccagcgctatgactcagatttccagaacatgctagagaagctgcagcccacggccgagaacgc
ctatgagctgttcaccaagatcgccttgagcctgtttgagagtggcatcaactggggccgcgtggtggctctcctggcct
tcggctaccgcctggccctgtacatctaccggcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
tttgtggtgcatcactgcatcgcccagtggatcgcgcagaggggcggctgggtggcagtcctgagctcgcacaaccccat
cctgacagtgctggcggccctggccgtggtcgcgttctgccagttcgtggtacgaagacacttcaagtcatga
>gnl|bcl2dbcds|G1SHS9_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BAK1 (length=633 residues).
atggcatccgggcaaggcccaggtcctcctggcgaaggctgtggagagcctcccgagccctccacttctgagcagcaggt
agcccgggacacggaggaggttttccgcagctacgttttccaccgccaccggcaggagcaggaggccgagggggcggctg
cccctgctgacccggagatgatctccttgcacctggaacctaacagcaccatggggcaggtggggcggcagctcgccatc
attggggacgacatcaaccagcgctatgactcagatttccagaacatgctagagaagctgcagcccacggccgagaacgc
ctatgagctgttcaccaagatcgccttgagcctgtttgagagtggcatcaactggggccgcgtggtggctctcctggcct
tcggctaccgcctggccctgtacatctaccggcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
tttgtggtgcatcactgcatcgcccagtggatcgcgcagaggggcggctgggtggcagtcctgagctcgcacaaccccat
cctgacagtgctggcggccctggccgtggtcgcgttctgccagttcgtggtacgaagacacttcaagtcatga
>gnl|bcl2dbcds|G1SQZ2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Oryctolagus cuniculus GN=BAX (length=579 residues).
agtccaggcgcctcttccctcctctctcctctagggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggaccgggccagccggatgggggggcagacgcccgagctggctgtggcgcaggggccccaggacg
agtccaccaagaagctgagcgagtgtctcaagcgcattggcgacgaactggacagtaacatggagctacagaggatgatc
gctgccgtggacacggactccccccgcgaggtctttttccgagtggcagccgacatgtttgccgacggcaacttcaactg
gggccgcgttgtcgccctgttttactttgccaccaagctggtactcaaggccctgtgcaccaaggtgcctgagctcatca
ggactattatgggctggacgctggacttcctccgagagcggctgctgggctggatccaagaccagggtggttgggacggc
ctcctctcctacttcgggacccccacgtggcaaacgctgaccatcttgggggccggagtgctcaccgcctcactcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|G1SQZ2_BAX-02 BCL2-associated X gene OS=[Eukaryota] Oryctolagus cuniculus GN=BAX (length=567 residues).
gccgggccagagttggggtcaggagggcccaccagctctgagcagatcatgaagacaggggcccttttgcttcagggttt
catccaggaccgggccagccggatgggggggcagacgcccgagctggctgtggcgcaggggccccaggacgagtccacca
agaagctgagcgagtgtctcaagcgcattggcgacgaactggacagtaacatggagctacagaggatgatcgctgccgtg
gacacggactccccccgcgaggtctttttccgagtggcagccgacatgtttgccgacggcaacttcaactggggccgcgt
tgtcgccctgttttactttgccaccaagctggtactcaaggccctgtgcaccaaggtgcctgagctcatcaggactatta
tgggctggacgctggacttcctccgagagcggctgctgggctggatccaagaccagggtggttgggacggcctcctctcc
tacttcgggacccccacgtggcaaacgctgaccatcttgggggccggagtgctcaccgcctcactcaccatctggaagaa
gatgggc
>gnl|bcl2dbcds|G1TXB3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Oryctolagus cuniculus GN=BOK (length=417 residues).
gacgagttggagctgattcggcccagtgtctaccgcaacgtggcccgccagctccacatctccctgcagtccgagcccgt
ggtgaccgacgcgttcctggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatg
ctgtggccgcagggctggccgtggactgcgtgcggcaggcccagcccgccatggtccacgccctggttgactgcctgggg
gagtttgtgcggaagaccctggccacctggctgcggcggcgcggcggatggaccgacgtgctcaagtgtgtggtcagcac
ggaccctggcctccgctcccactggctcctggctgcgctctgcagcctcggccgcttcctcaaggcggctgtctttgtgc
tgttgccggagagatga
© 1998-2018