Dataset for CDS BAX of Organism Oryctolagus cuniculus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G1SQZ2_BAX-02 BCL2-associated X gene OS=[Eukaryota] Oryctolagus cuniculus GN=BAX (length=567 residues).
gccgggccagagttggggtcaggagggcccaccagctctgagcagatcatgaagacaggggcccttttgcttcagggttt
catccaggaccgggccagccggatgggggggcagacgcccgagctggctgtggcgcaggggccccaggacgagtccacca
agaagctgagcgagtgtctcaagcgcattggcgacgaactggacagtaacatggagctacagaggatgatcgctgccgtg
gacacggactccccccgcgaggtctttttccgagtggcagccgacatgtttgccgacggcaacttcaactggggccgcgt
tgtcgccctgttttactttgccaccaagctggtactcaaggccctgtgcaccaaggtgcctgagctcatcaggactatta
tgggctggacgctggacttcctccgagagcggctgctgggctggatccaagaccagggtggttgggacggcctcctctcc
tacttcgggacccccacgtggcaaacgctgaccatcttgggggccggagtgctcaccgcctcactcaccatctggaagaa
gatgggc
>gnl|bcl2dbcds|G1SQZ2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Oryctolagus cuniculus GN=BAX (length=579 residues).
agtccaggcgcctcttccctcctctctcctctagggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggaccgggccagccggatgggggggcagacgcccgagctggctgtggcgcaggggccccaggacg
agtccaccaagaagctgagcgagtgtctcaagcgcattggcgacgaactggacagtaacatggagctacagaggatgatc
gctgccgtggacacggactccccccgcgaggtctttttccgagtggcagccgacatgtttgccgacggcaacttcaactg
gggccgcgttgtcgccctgttttactttgccaccaagctggtactcaaggccctgtgcaccaaggtgcctgagctcatca
ggactattatgggctggacgctggacttcctccgagagcggctgctgggctggatccaagaccagggtggttgggacggc
ctcctctcctacttcgggacccccacgtggcaaacgctgaccatcttgggggccggagtgctcaccgcctcactcaccat
ctggaagaagatgggctga
© 1998-2018