Dataset for CDS BAK1 of Organism Oryctolagus cuniculus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G1SHS9_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BAK1 (length=633 residues).
atggcatccgggcaaggcccaggtcctcctggcgaaggctgtggagagcctcccgagccctccacttctgagcagcaggt
agcccgggacacggaggaggttttccgcagctacgttttccaccgccaccggcaggagcaggaggccgagggggcggctg
cccctgctgacccggagatgatctccttgcacctggaacctaacagcaccatggggcaggtggggcggcagctcgccatc
attggggacgacatcaaccagcgctatgactcagatttccagaacatgctagagaagctgcagcccacggccgagaacgc
ctatgagctgttcaccaagatcgccttgagcctgtttgagagtggcatcaactggggccgcgtggtggctctcctggcct
tcggctaccgcctggccctgtacatctaccggcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
tttgtggtgcatcactgcatcgcccagtggatcgcgcagaggggcggctgggtggcagtcctgagctcgcacaaccccat
cctgacagtgctggcggccctggccgtggtcgcgttctgccagttcgtggtacgaagacacttcaagtcatga
>gnl|bcl2dbcds|G1SHS9_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BAK1 (length=633 residues).
atggcatccgggcaaggcccaggtcctcctggcgaaggctgtggagagcctcccgagccctccacttctgagcagcaggt
agcccgggacacggaggaggttttccgcagctacgttttccaccgccaccggcaggagcaggaggccgagggggcggctg
cccctgctgacccggagatgatctccttgcacctggaacctaacagcaccatggggcaggtggggcggcagctcgccatc
attggggacgacatcaaccagcgctatgactcagatttccagaacatgctagagaagctgcagcccacggccgagaacgc
ctatgagctgttcaccaagatcgccttgagcctgtttgagagtggcatcaactggggccgcgtggtggctctcctggcct
tcggctaccgcctggccctgtacatctaccggcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
tttgtggtgcatcactgcatcgcccagtggatcgcgcagaggggcggctgggtggcagtcctgagctcgcacaaccccat
cctgacagtgctggcggccctggccgtggtcgcgttctgccagttcgtggtacgaagacacttcaagtcatga
© 1998-2018