Dataset for CDS Unclassified of Organism Oreochromis niloticus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|I3JM41_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Oreochromis niloticus (length=438 residues).
atgatacgtgtcgtcggtgacagagtgcagcatgaccaggagtttcaagatgtgatagatggtgtggcttctggctctgg
ctccaagtcagagagattcagacaagtggcagacaaagtgtttgaggacggcatcacctgggagagaatcgctgtgctca
tctatgtagccggcaggcttgctgtcaagatggtcgaggctcacctccctcagtcagtgagagaggtccttacctgggca
gtgaactttttcaaaaacaatctgctgggctggattcaggaacacggaggttggatcaacagcttctcagagttggcagc
tgcatccatccagagggtgtcatcaatgagctctcacagctacggccttatcatcatattcctcgctggcatgtctatag
gaagcttcatcacctggaggctgaccagacagtcttga
© 1998-2018