Dataset for CDS BAX-like of Organism Oreochromis niloticus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|I3IYF0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Oreochromis niloticus GN=BAX (length=399 residues).
atggcatcacacccaggaggaggcgatcaagggaattccggagatcagatactggaagtcggaactattttgttacagga
tttcatctatgagcgagttcagaggcaaaaagatggcaataaagcagtgacgagagaacagcttggtggaagccagttga
ctgacccaaaaactaagaagcttgctcagtgcctgcagcagattggagacgagctggatggaaatgtagacctccaaaga
atgataaatgactcttcactttgtcccacaagagaggtttttatgagagtggcctatgagatcttttcagatggaatatt
taactggggcagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
>gnl|bcl2dbcds|I3JU52_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Oreochromis niloticus GN=BOK (length=642 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtttcccagtctaaggcgctgtgcagagactacatcctgtcgaggctcaaccagaacgggttgggatggtccaaaactg
agctcaatttttctccctcgaacgcagcgctagctgaagtatctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcaactcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggcgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtacgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggccacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagagacggggaggatgggtggagatcacaaaatgtgtggtaaagaaggatctttcccctga
agaaaactggctgtcctccgcctttgagtccctcaagtacttcctcaccaccatgtacgtctacattatgaaggagccgt
ga
>gnl|bcl2dbcds|I3JU52_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Oreochromis niloticus GN=BOK (length=675 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtttcccagtctaaggcgctgtgcagagactacatcctgtcgaggctcaaccagaacgggttgggatggtccaaaactg
agctcaatttttctccctcgaacgcagcgctagctgaagtatctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcgcggcaactcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggcgtagcaacagagattttctcacgtaaagccagcaggtcccatcttgggcctcacataggcataacatggggta
aggtggtgtccatgtacgcggtagctggagccctggcagtggactgtgtcagacaaggccatccggccacagtgcacatc
ttagtggacagtctgggacagtttgtccgcaaattcctggttccctggctgaagagacggggaggatgggtggagatcac
aaaatgtgtggtaaagaaggatctttcccctgaagaaaactggctgtcctccgcctttgagtccctcaagtacttcctca
ccaccatgtacgtctacattatgaaggagccgtga
>gnl|bcl2dbcds|I3KNV2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Oreochromis niloticus GN=BAX (length=612 residues).
atggctgacggccgagagggggagaatccggagcaggagcctaggggcgccgcgggtggagacgatgtcattgatgatcc
catcctcgaagaaggagcggttgtctttagagggtatgtgattgcacatataaacacagaggaccctagtcgacatgtga
cttctgaggatttgggaggaaggccagatgaacaacaggatccacaaatcaaagaagtggtagaacagctgcgcaagata
gcggacagtttaaatcggaatgctgaacttcagaggctgataaaccaggttcaggggaactgtgctcaagacgtcttcat
gactgttgcaagaaacatctttgctgatggtatcaactggggtcgaatagtggctctcttccatctggcctgtaaactta
tacacaaggctattaccgccaatcacttggagaacatccaaatgatcatcagctgggtcctccaggttatcagagagcag
gtctacagctggcttgtggcgcaagggggctgggagggggtgatccgtggtttttctcgatggaggacagcagccatggt
agcatcagtagtattggtggtagccttcgtttactaccggaaagtacgataa
>gnl|bcl2dbcds|I3KT16_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Oreochromis niloticus GN=BOK (length=633 residues).
atggagatgttgcgtcgctcctctgtgtttgcctctgaagtgtttgaccgctcgcccaccgacaaggagctggtgtccca
agccaaagcactgtgcagggaatacatccactccaggctgaaccgtgccgggatcggctggtccaagcctgaacacggac
tggctgcatcaggtgggacactgggagagatatcgtcggtcctgctgtggctgggcgatgagttggagtaccttcgtccc
aatgtgtaccgtaacgtcgcccgacagctgaacatcacagtggcatcggagagcgtggtgtccgacgctttcctagctgt
cgctgcagacattttctccacaggtgtgacatggggaaaggtggtttccttgtacgctgtggcgggagccttggcggtgg
actgtgtccgccatggtcatccagcaatggtccataccattgtcgactgcatgggggagtttgtccgcaagagcctgatt
tcctggttaaaaaagagaggaggctgggtggatgtaacaaagtgcgtggtgagcactgacccaaacttctgttctcactg
gctggtgtctgctgtctgtgcctttggacactacctgaagacggtcgtgctacacctcctccgcgagaagtga
© 1998-2018